KEY RESOURCES TABLE.
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti-ADRM1 (hRpn13) | Novus Biologics | Cat#NBP1–30447; RRID: AB_2225663 |
| Mouse monoclonal anti-GAPDH 6C5 | Santa Cruz Biotechnology | Cat#Sc-32233; RRID: AB_627679 |
| Rabbit polyclonal anti-20S proteasome beta 5 subunit | Enzo Life Sciences | Cat#BML-PW8895–0025; RRID: AB_2052392 |
| Rabbit monoclonal anti-UCH37 [EP4897] | Abcam | Cat#Ab133508; RRID: AB_2814821 |
| Monoclonal anti-FLAG M2 | Sigma-Aldrich | Cat#F1804; RRID: AB_262044 |
| REEP5 antibody | Proteintech Cat#14643–1-AP | Cat#14643–1-AP; RRID AB_2178440 |
| OCIAD1 antibody | Novus NBP1–76242 | Cat#NBP1–76242; RRID AB_11035850 |
| CYB5B antibody | Proteintech Cat# 15469–1-AP | Cat#15469–1-AP; RRID AB_2230349 |
| C18orf32 antibody | Thermo Fisher PA5–59354 | Cat#PA5–59354; RRID AB_2638853 |
| Goat anti-rabbit 800CW | Licor | Cat#925–32211; RRID: AB_2651127 |
| Donkey anti-mouse 680RD | Licor | Cat#925–32212; RRID: AB_27116622 |
| Bacterial and Virus Strains | ||
| BL21(DE3)pLysS competent cells | Promega | Cat#L1195 |
| XL-10 Gold Ultracompetent cells | Stratagene | Cat#200314 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Streptavidin 680RD | Licor | Cat#926–68079 |
| RA190 | Synthesized as reported | Anchoori, et al. 2013 |
| Biotin-RA190 | Synthesized as reported | Anchoori, et al. 2013 |
| Alkyne-RA190 | This paper | N/A |
| KDT-11 | Synthesized as reported | Trader, et al. 2015 |
| Bortezomib | LC Laboratories | Cat#B140825MG |
| Ubiquitin-fluorescein | Prepared as reported | Du, et al. 2017 |
| Omnifect transfection reagent | Transomic | Cat#OTR1003 |
| TAMRA azide | Click Chemistry Tools | Cat#AZ109 |
| Tris(2-carboyxlethyl)phosphine- HCl (TCEP) | Sigma | Cat#C4706 |
| Tris(benzyltriazolylmethyl)amine (TBTA) | Click Chemistry Tools | Cat#1061 |
| Copper (II) sulfate | Sigma | Cat#C1297 |
| Critical Commercial Assays | ||
| CellTiter-Glo 2 0 Cell Viability Assay | Promega | Cat#G9241 |
| Click-iT EdU Alexa Fluor 647 Flow cytometry assay | Life Technologies | Cat#C10424 |
| Proteasome purification kit | Enzo Life Sciences | Cat#BML-PW1075A-0001 |
| Experimental Models: Cell Lines | ||
| MM1.R myeloma cell line, Homo sapiens | ATCC | Cat#CRL-2975; RRID: CVCL_8794 |
| MM1.S myeloma cell line, Homo sapiens | ATCC | Cat#CRL-2974; RRID: CVCL_8792 |
| SK-MEL-5 melanoma cell line, Homo sapiens | ATCC | Cat#HTB-70; RRID: CVCL_0527 |
| HEK293T kidney cell line, Homo sapiens | ATCC | Cat#CRL-3216; RRID: CVCL_0063 |
| MDA-MB-231 breast cancer cell line, Homo sapiens | ATCC | Cat#HTB-26; RRID: CVCL_0062 |
| HeLa cervical cancer cell line, Homo sapiens | ATCC | Cat#CCL-2; RRID: CVCL_0030 |
| A549 lung cancer cell line, Homo sapiens | ATCC | Cat#CCL-185; RRID: CVCL_0023 |
| Peripheral blood mononuclear cells (PBMCs) | Stem Cell | Cat#70025.1 |
| Chronic Lymphocytic Leukemia cells (CLL3007) | Nicholas Chiorazzi lab, Feinstein Institute for Medical Research | Sarkar, et al. 2016 |
| Oligonucleotides | ||
| ON-TARGETplus Rpn13 (11047) siRNA SMARTpool | Dharmacon | Cat#L-012340–01 |
| ON-TARGETplus GAPDH siRNA SMARTpool | Dharmacon | Cat#D-001830–10 |
| Custom ADRM1 (Rpn13) duplex ON-TARGET siRNA - UTR1 Rpn13 Sense:5'AGGAAGAGCGAGCCCGGACUU3' Antisense:5'GUCCGGGCUCGCUCUUCCUUU3' |
Dharmacon | Cat#CTM-485557 |
| ON-TARGETplus nontargeting siRNA pool | Dharmacon | Cat#D-001810–10 |
| ON-TARGETplus CYB5B (80777) siRNA SMARTpool | Dharmacon | Cat#L-014633–02 |
| ON-TARGETplus C18orf32 (497661) siRNA SMARTpool | Dharmacon | Cat#L-034916–02 |
| ON-TARGETplus OCIAD1 (54940) siRNA SMARTpool | Dharmacon | Cat#L-020825–02 |
| ON-TARGETplus REEP5 (7905) siRNA SMARTpool | Dharmacon | Cat#L-019467–01 |
| Site directed mutagenesis forward primer 5’ GCTGGGGGCCTGCGGCACCCGCTTGAACTCACAGTCGTC 3’ |
IDT | N/A |
| Site directed mutagenesis reverse primer 5’ CCGCAGGCCCCCAGCGGGAGGGTCTACGTGCTGAAGTTC 3’ |
IDT | N/A |
| Recombinant DNA | ||
| pcDNA5 FLAG-ADRM1 | Yao, et al., 2006 | Addgene #19417; RRID: Addgene_19417 |
| Pet19b His6 ADRM1 | Yao, et al., 2006 | Addgene #19423; RRID: Addgene_19423 |
| pcDNA5 FLAG-Rpn13_C88A | This paper | N/A |
| Pet19b His6 Rpn13_C88A | This paper | N/A |
| Rpn2 plasmid FLAG-Rpn2 | Kylie Walters lab, National Cancer Institute | Lu, et al. 2015 |
| pVP16 MBP-Uch37 | DNASU | ID#84019 |
| Software and Algorithms | ||
| ImageJ | https://imagej.nih.gov/ij/ | RRID: SCR_003070 |
| Licor Image Studio Software | LI-COR Image Studio Software | RRID: SCR_015795 |
| Prism 8 | Graphpad | RRID:SCR_000306 |
| FlowJo | FlowJo LLC | RRID: SCR_008520 |
| MaxQuant V1.6.1.0 | Cox and Mann, 2008 | RRID:SCR_014485 |
| Geneious | Geneious | RRID: SCR_010519 |
| ChemDraw | PerkinElmer | RRID: SCR_016768 |
| Other | ||
| Amylose resin | NEB | Cat#E8021S |
| Ni-NTA resin | Qiagen | Cat#30210 |
| Protein G Plus agarose | Thermo Fisher | Cat#22851 |
| 4–20% Mini-PROTEAN Gels | Biorad | Cat#4561096 |
| Fetal Bovine Serum, Heat inactivated | Life technologies | Cat#16140–071 |
| KOD HotStart PCR Master Mix | EMD Millipore | Cat#71842 |
| Mycoplasma PCR Test Kit | ABM Good | Cat#G238 |