KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-Drp1 | BD Biosciences | Cat#611113; RRID: AB_398424 |
| Mouse monoclonal anti-PDH | Abcam | Cat#ab110333; RRID: AB_10862029 |
| Rabbit polyclonal anti-Tom20 | Santa Cruz Biotechnology | Cat#sc-11415; RRID: AB_2207533 |
| Mouse monoclonal anti-GAPDH | Thermo Fisher Scientific | Cat#MA5–15738; RRID: AB_10977387 |
| Goat polyclonal anti-HA | Novus | Cat#NB600–362; RRID: AB_10124937 |
| Rat monoclonal anti-mCherry | Thermo Fisher Scientific | Cat#M11217; RRID: AB_2536611 |
| Rabbit polyclonal anti-Rtn4 (Nogo A+B) | Abcam | Cat#ab47085; RRID: AB_881718 |
| Rabbit polyclonal anti-Bip | Abcam | Cat#ab21685; RRID: AB_2119834 |
| Rabbit polyclonal anti-Fis1 | Enzo Life Sciences | Cat#ALX-210-1037; RRID: AB_2737586 |
| Rabbit polyclonal anti-PEX14 | Proteintech | Cat#10594-1-AP; RRID: AB_2252194 |
| Rabbit polyclonal anti-GFP | Senoo et al., Nat Cell Biol 2019 | N/A |
| Rabbit polyclonal anti-Mff | Gandre-Babbe and van der Bliek, Mol. Cell Biol 2008 | N/A |
| Alexa 405 anti-rabbit IgG | Abcam | Cat#ab175658; RRID: AB_2687445 |
| Alexa 488 anti-mouse IgG | Thermo Fisher Scientific | Cat#A21202; RRID: AB_141607 |
| Alexa 488 anti-rabbit IgG | Thermo Fisher Scientific | Cat#A21206; RRID: AB_2535792 |
| Alexa 488 anti-goat IgG | Thermo Fisher Scientific | Cat#A21467; RRID:AB_2535870 |
| Alexa 568 anti-mouse IgG | Thermo Fisher Scientific | Cat#A10037; RRID: AB_2534013 |
| Alexa 568 anti-rabbit IgG | Thermo Fisher Scientific | Cat#A10042; RRID: AB_2534017 |
| Alexa 568 anti-rat IgG | Abcam | Cat#AB175475; RRID: AB_2636887 |
| Alexa 647 anti-mouse IgG | Thermo Fisher Scientific | Cat#A31571; RRID: AB_162542 |
| Alexa 647 anti-goat IgG | Thermo Fisher Scientific | Cat#A21447; RRID: AB_2535864 |
| Bacterial and Virus Strains | ||
| Rosetta™ 2(DE3)pLysS competent cells | EMD Millipore | Cat#71403 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Chloroform | Sigma-Aldrich | Cat#C2432 |
| MES (2-morpholinoethanesulfonic acid, mono hydrate) | Sigma-Aldrich | Cat#M8250 |
| Sucrose | Thermo Fisher Scientific | Cat#S5–3 |
| beta-D-Galactopyranoside, Isopropyl-beta-D-thiogalactopyranoside (IPTG) | AMRESCO | Cat#0487 |
| HEPES | Thermo Fisher Scientific | Cat#BP310–1 |
| Imidazole | Sigma-Aldrich | Cat#I0125 |
| Coomassie Brilliant Blue R-250 | AMRESCO | Cat#M128 |
| 50% Ni-NTA beads | EMD Millipore | Cat#70666 |
| 4–20% Criterion TGX Precast Gel | Bio-Rad Laboratories | Cat#5671095 |
| DMSO | Sigma-Aldrich | Cat#D5879 |
| 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphocholine (POPC) | Avanti Polar Lipids | Cat#850457 |
| 1-palmitoyl-2-oleoyl-sn-glycero-3-phosphoethanolamine (POPE) | Avanti Polar Lipids | Cat#850757 |
| L-α-phosphatidylinositol (Liver PI) | Avanti Polar Lipids | Cat#840042 |
| 1-palmitoyl-2-oleoyl-sn-glycero-3-phospho-L-serine (POPS) | Avanti Polar Lipids | Cat#840034 |
| 1,2-dipalmitoyl-sn-glycero-3-phosphocholine (DPPC) | Avanti Polar Lipids | Cat#850355 |
| 1,2-dipalmitoyl-sn-glycero-3-phosphoethanolamine-N-(lissamine rhodamine B sulfonyl) (rhodamine-DPPE) | Avanti Polar Lipids | Cat#810158 |
| 1,2-dipalmitoyl-sn-glycero-3-phosphate (DPPA) | Avanti Polar Lipids | Cat#830855 |
| 1,2-dipalmitoyl-sn-glycero-3-phosphate (DPPA) | Echelon Biosciences | Cat#L-4116 |
| IMDM | Gibco | Cat#12440053 |
| Dulbecco’s Modified Eagle’s Medium - high glucose | Sigma-Aldrich | Cat#D5796 |
| Dulbecco’s Phosphate Buffered Saline | Sigma-Aldrich | Cat#D8537 |
| Fetal Bovine Serum | Sigma-Aldrich | Cat#F6178 |
| RIPA Buffer (10X) | Cell Signaling Technology | Cat#9806 |
| D-Mannitol | Sigma-Aldrich | Cat#M4125 |
| collagenase I | Gibco | Cat#17018029 |
| Williams’ medium E | Gibco | Cat#A1217601 |
| Collagen I | Gibco | Cat#A1048301 |
| Primary Hepatocyte Thawing and Plating Supplements | Gibco | Cat#CM3000 |
| Octadecapeptide554–571 (GMLKTSKAEELLAEEKSK) | This paper | N/A |
| KA octadecapeptide554–571 (GMLATSAAEELLAEEASA) | This paper | N/A |
| peptide554–565 (GMLKTSKAEELL) | This paper | N/A |
| peptide561–571 (AEELLAEEKSK) | This paper | N/A |
| biotin-conjugated octadecapeptide554–571 | This paper | N/A |
| biotin-conjugated KA octadecapeptide554–571 | This paper | N/A |
| TAT (GRKKRRQRRRPQ)-fused octadecapeptide554–571 | This paper | N/A |
| TAT-fused KA octadecapeptide554–571 | This paper | N/A |
| FITC-conjugated octadecapeptide554–571 | This paper | N/A |
| FITC-conjugated KA octadecapeptide554–571 | This paper | N/A |
| Uranyl Acetate 98%, ACS Reagent | Polysciences, Inc. | Cat#21447–25 |
| Tylose® MH 300 | Sigma-Aldrich | Cat#93800 |
| cOmplete™, Mini, EDTA-free Protease Inhibitor Cocktail | Roche | Cat#11836170001 |
| Critical Commercial Assays | ||
| Malachite Green Solution | Echelon Biosciences | Cat#K-1501 |
| Gibson Assembly® Master Mix | NEB | Cat#E2611 |
| Quick Ligation™ Kit | NEB | Cat#M2200 |
| Phusion® High-Fidelity DNA Polymerase | NEB | Cat#M0530 |
| Lipofectamine 2000 Transfection Reagent | Thermo Fisher Scientific | Cat#11668019 |
| Lipofectamine™ 3000 Transfection Reagent | Thermo Fisher Scientific | Cat#L3000150 |
| Biotin-Streptavidin Sensors Kit | Nicoya | Cat#NI SENAU100–10-STR |
| EM grids | Electron Microscopy Sciences | Cat#CF400-CU |
| Nuclepore™ Track-Etched Membranes | Whatman | Cat#800282 |
| GeneArt™ CRISPR Nuclease Vector with OFP Reporter Kit | Thermo Fisher Scientific | Cat#A21174 |
| Experimental Models: Cell Lines | ||
| Mouse embryonic fibroblasts (MEFs) | Wakabayashi et al., J. Cell Biol. 2009 | N/A |
| Drp1-KO MEFs | Wakabayashi et al., J. Cell Biol. 2009 | N/A |
| Mff/Fis1-KO MEFs | Loson et al., Mol Biol Cell 2013 | N/A |
| Hela cells | Otera et al., J Cell Biol. 2016 | N/A |
| Drp1-KO Hela cells | Otera et al., J Cell Biol. 2016 | N/A |
| Mff/Fis1-KO Hela cells | Otera et al., J Cell Biol. 2016 | N/A |
| Rtn4a-KO MEFs | This paper | N/A |
| HEK293T cells | ATCC | CRL-3216 |
| Experimental Models: Organisms/Strains | ||
| Mouse: Alb-Cre+/−::Drp1flox/flox | Yamada et al., Cell Metab 2018 | N/A |
| Oligonucleotides | ||
| CRISPR KO target sequence; Rtn4a CCAGGTAACACTGTTTCGTC |
This paper | N/A |
| shRNA target sequence; Scramble CCTAAGGTTAAGTCGCCCTCGttcaagagaCGAGGGCGACTTAACCTTAGG |
This paper | N/A |
| shRNA target sequence; Drp1 GCTTCAGATCAGAGAACTTATttcaagagaATAAGTTCTCTGATCTGAAGC |
This paper | N/A |
| Recombinant DNA | ||
| pHR-SIN Drp1 WT | This paper | N/A |
| pHR-SIN Drp1 K38A | This paper | N/A |
| pHR-SIN Drp1 G350D | This paper | N/A |
| pHR-SIN Drp1 K38, G350D | This paper | N/A |
| pHR-SIN Drp1 503–539 | This paper | N/A |
| pHR-SIN Drp1 540–599 | This paper | N/A |
| pHR-SIN Drp1 540–575 | This paper | N/A |
| pHR-SIN Drp1 570–599 | This paper | N/A |
| pHR-SIN Drp1 554–571 | This paper | N/A |
| pHR-SIN Drp1 554–565 | This paper | N/A |
| pHR-SIN Drp1 561–571 | This paper | N/A |
| pHR-SIN Drp1 Δ557–569 | This paper | N/A |
| pHR-SIN Drp1 KA | This paper | N/A |
| pHR-SIN HA-Drp1 S-V | This paper | N/A |
| pHR-SIN HA-Drp1 G-S | This paper | N/A |
| pHR-SIN HA-Drp1 V | This paper | N/A |
| pHR-SIN HA-Drp1 S | This paper | N/A |
| pHR-CMV8.2ΔR | Stewart et al., RNA 2003 | Addgene Plasmid #8455 |
| pCMV-VSVG | Stewart et al., RNA 2003 | Addgene Plasmid #8454 |
| pET15b His6-tagged Drp1 | Adachi et al., Mol Cell. 2016 | N/A |
| pET15b His6-tagged Drp1Δ557–569 | This paper | N/A |
| pET15b His6-tagged Drp1 K38A | This paper | N/A |
| GFP-Sec61β | Friedman et al., Science. 2011 | Addgene Plasmid #15108 |
| mCherry-Sec61β | This paper | N/A |
| Rtn4a-GFP | Shibata et al J Biol Chem. 2008 | Addgene Plasmid #61807 |
| HA-Climp63 | This paper | N/A |
| Su9-HA-iRFP670 | This paper | N/A |
| GFP-KDEL | This paper | N/A |
| GFP-Cyb5 | This paper | N/A |
| Software and Algorithms | ||
| Delta Vision OMX Master Control software | GE Healthcare Life Sciences | N/A |
| SoftWoRx reconstruction and analysis software | GE Healthcare Life Sciences | N/A |
| Image J | NIH | https://imagej.nih.gov/ij/index.html |
| Prism | GraphPad | https://www.graphpad.com/scientific-software/prism/ |