Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Short hairpin RNA target sequences.
| Clone name | Symbol | Location | Length, bp | Target sequence (5′-3′) |
|---|---|---|---|---|
| HSH054754-CU6-a(OS397039) | TLR4 | 890 | 21 | GCTCACAATCTTATCCAATCT |
| HSH054754-CU6-b(OS397040) | TLR4 | 678 | 21 | GGTGTGAAATCCAGACAATTG |
| HSH054754-CU6-c(OS397041) | TLR4 | 887 | 21 | GTGGCTCACAATCTTATCCAA |
TLR4, toll-like receptor 4.
