Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Other | ZDHHC14 | GenBank | NP_078906.2 | Protein (Homo sapiens) |
| Other | ZDHHC14 | GenBank | NP_666185.3 | Protein (Mus musculus) |
| Other | ZDHHC14 | GenBank | NP_001034432.1 | Protein (Rattus norvegicus) |
| Other | ZDHHC14 | GenBank | XP_004914695.1 | Protein (Xenopus tropicalis) |
| Other | ZDHHC14 | GenBank | XP_005160409.1 | Protein (Danio rerio) |
| Other | ZDHHC14 | GenBank | XP_002127630.1 | Protein (Ciona intestinalis) |
| Other | app (approximated) | GenBank | NP_001137937.1 | Protein (Drosophila melanogaster) |
| Other | DHHC-2 | GenBank | NP_0493007.2 | Protein (Caenorhabditis elegans) |
| Other | PSD93β (Dlg2 gene product) | GenBank | XP_017445141.1 | Protein (R. norvegicus) |
| Other | PSD93β | GenBank | NP_001338205.1 | Protein (H. sapiens) |
| Other | Kv1.1 | GenBank | NP_775118.1 | Protein (R. norvegicus) |
| Other | Kv1.2 | GenBank | NP_037102.1 | Protein (R. norvegicus) |
| Other | Kv1.4 | GenBank | NP_037103.1 | Protein (R. norvegicus) |
| Other | Kv1.1 | GenBank | NP_000208.2 | Protein (H. sapiens) |
| Other | Kv1.1 | GenBank | NP_034725.3 | Protein (M. musculus) |
| Other | Kv1.1 | GenBank | XP_004912858.1 | Protein (X. tropicalis) |
| Other | Kv1.1 | GenBank | XP_005163101.1 | Protein (D. rerio) |
| Other | Sh (Shaker) | GenBank | NP_523393.3 | Protein (D. melanogaster) |
| Other | SHK-1 | GenBank | NP_871935.1 | Protein (C. elegans) |
| Recombinant DNA reagent | FEW-PSD93α-myc | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-PSD93β-myc | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-PSD93β-myc C10S | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-PSD93β-myc C16,18S | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-PSD93β-myc C10,16,18S | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-PSD93β-myc 5CS | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express R. norvegicus cDNA |
| Recombinant DNA reagent | FEW-HA-Zdhhc14 | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express M. musculus cDNA |
| Recombinant DNA reagent | FEW-HA-Zdhhc14 LSSE | This paper | Source: Thomas Lab | Lentiviral construct to transfect (HEK293 cells and rat neurons) and express M. musculus cDNA |
| Recombinant DNA reagent | FUGW | Addgene | Cat #14883 (RRID:Addgene_14883) | Lentiviral construct to transduce rat neurons and express Human UbC-driven EGFP |
| Recombinant DNA reagent | FUGW H1-Zdhhc14sh#1 | This paper | Source: Thomas Lab | Lentiviral construct to transduce rat neurons and express Human UbC-driven EGFP and H1-driven shRNA (sequence: GCATTCAGAGCACCAAATTCGT) |
| Recombinant DNA reagent | FUGW H1-Zdhhc14sh#2 | This paper | Source: Thomas Lab | Lentiviral construct to transduce rat neurons and express Human UbC-driven EGFP and H1-driven shRNA (sequence: GCCACACTCTCAGACATTAT) |
| Recombinant DNA reagent | pAAV-GFP-Zdhhc14sh#1 | This paper | Source: Thomas Lab | AAV construct to transduce rat neurons and express EGFP and shRNA Backbone Addgene plasmid #26937 |
| Recombinant DNA reagent | pPC97 | Dong et al., 1997 | ||
| Recombinant DNA reagent | pPC97 wild type Zdhhc14 C-term tail | This paper | Source: Thomas Lab | Zdhhc14 M. musculus gene fragment |
| Recombinant DNA reagent | pPC97 Zdhhc14 C-term tail LSSE | This paper | Source: Thomas Lab | Zdhhc14 M. musculus gene fragment |
| Recombinant DNA reagent | pPC86 | Dong et al., 1997 | ||
| Recombinant DNA reagent | pPC86 PSD93 PDZ3 | This paper | Source: Thomas Lab | Dlg2 (Psd93) M. musculus gene fragment |
| Recombinant DNA reagent | pCIS GST-Zdhhc14 C-term tail | This paper | Source: Thomas Lab | Zdhhc14 M. musculus gene fragment transfected in HEK293T cells |
| Recombinant DNA reagent | pCIS GST-Zdhhc14 C-term tail LSSV | This paper | Source: Thomas Lab | Zdhhc14 M. musculus gene fragment transfected in HEK293T cells |
| Recombinant DNA reagent | pMDLg | Addgene | Cat #12251 (RRID:Addgene_12251) | Lentiviral Gag and Pol expressing plasmid |
| Recombinant DNA reagent | pRSV-Rev | Addgene | Cat #12253 (RRID:Addgene_12253) | Lentiviral Rev expressing plasmid |
| Recombinant DNA reagent | pMD2.G | Addgene | Cat #12259 (RRID:Addgene_12259) | Lentiviral VSV-G envelope expressing plasmid |
| Recombinant DNA reagent | pHelper | Agilent | Cat #240071 | |
| Recombinant DNA reagent | pAAV-RC | Agilent | Cat #240071 | |
| Strain, strain background (S. cerevisiae) | PJ69 | James et al., 1996 | ||
| Strain, strain background (S. cerevisiae) | HF7C | Feilotter et al., 1994 | ||
| Biological sample (R. norvegicus) | Primary hippocampal neurons | Charles River | Freshly isolated from embryonic day 18 hippocampi | |
| Antibody | Anti-PSD93 (mouse monoclonal IgG1) | NeuroMab | Cat #75–057 (RRID:AB_2277296) | WB (1:500) IF (1:100) |
| Antibody | Anti-Kv1.1 (mouse IgG2b) | NeuroMab | Cat #75–105 (RRID:AB_2128566) | WB (1:500) IF (1:100) |
| Antibody | Anti-Kv1.2 (mouse monoclonal IgG2b) | NeuroMab | Cat #75–008 (RRID:AB_2296313) | WB (1:500) IF (1:100) |
| Antibody | Anti-Kv1.4 (mouse monoclonal IgG1) | NeuroMab | Cat #75–010 (RRID:AB_2249726) | WB (1:500) IF (1:100) |
| Antibody | Anti-GluN2B (mouse monoclonal IgG2b) | NeuroMab | Cat #75–101 (RRID:AB_2232584) | WB (1:200) |
| Antibody | Anti-AnkG (mouse monoclonal IgG2a) | NeuroMab | Cat #75–146 (RRID:AB_10673030) | IF (1:200) |
| Antibody | Anti-GST (rabbit polyclonal) | Bethyl Laboratories | Cat #A190-122A (RRID:AB_67419) | WB (1:5000) |
| Antibody | Anti-HA tag (rabbit monoclonal) | Cell Signaling Technologies | Cat #3724 (RRID:AB_1549585) | WB (1:5000) |
| Antibody | Anti-Erk1/2 (rabbit monoclonal) | Cell Signaling Technologies | Cat #4696 (RRID:AB_390780) | WB (1:1000) |
| Antibody | Anti-Histone H3 (rabbit monoclonal) | Cell Signaling Technologies | Cat #4499 (RRID:AB_10544537) | WB (1:1000) |
| Antibody | Anti-Myc tag (rabbit monoclonal) | Cell Signaling Technologies | Cat #2278 (RRID:AB_490778) | WB (1:5000) IF (1:500) |
| Antibody | Anti-GAP43 (rabbit polyclonal) | Novus Biologicals | Cat #NB300-143 (RRID:AB_10001196) | WB (1:5000) |
| Antibody | Anti-GFP (chicken polyclonal) | Millipore-Sigma | Cat #AB16901 (RRID:AB_90890) | IF (1:500) |
| Antibody | Anti-GFP (rabbit polyclonal) | Thermo-Fisher Scientific | Cat #A-11122 | IF (1:1000) |
| Antibody | Sheep anti-mouse HRP-linked polyclonal | Millipore-Sigma | Cat #NA931 | WB (1:5000) |
| Antibody | Donkey anti-rabbit HRP-linked polyclonal | Jackson Immunoresearch | Cat #711–0350152 | WB (1:5000) |
| Antibody | AlexaFluor 488 goat anti-chicken polyclonal | Thermo Fisher Scientific | Cat #A-11039 (RRID:AB_142924) | IF (1:500) |
| Antibody | AlexaFluor 488 goat anti-rabbit polyclonal | Thermo Fisher Scientific | Cat #A-11032 (RRID:AB_2534091) | IF (1:500) |
| Antibody | AlexaFluor 568 goat anti-rabbit polyclonal | Thermo Fisher Scientific | Cat #A-11011 (RRID:AB_143157) | IF (1:500) |
| Antibody | AlexaFluor 568 goat anti-IgG2a polyclonal | Thermo Fisher Scientific | Cat #A-21134 (RRID:AB_2535773) | IF (1:500) |
| Antibody | AlexaFluor 647 goat anti-IgG2a polyclonal | Thermo Fisher Scientific | Cat #A-21241 (RRID:AB_141698) | IF (1:500) |
| Antibody | AlexaFluor 647 goat anti-IgG1 polyclonal | Thermo Fisher Scientific | Cat #A-21240 (RRID:AB_141658) | IF (1:500) |
| Antibody | AlexaFluor 647 goat anti-IgG2b polyclonal | Thermo Fisher Scientific | Cat #A-21242 (RRID:AB_2535811) | IF (1:500) |
| Antibody | Anti-ZDHHC14 rabbit polyclonal | This paper | Source: Thomas Lab | Immunogen: CDSLHEDSVRGLVKLSSV WB (1:200) |
| Chemical compound, drug | MMTS | Thermo Fisher Scientific | Cat #23011 | |
| Chemical compound, drug | Hydroxylamine | Thermo Fisher Scientific | Cat #26103 | |
| Chemical compound, drug | Biotin-HPDP | Soltec Ventures | Cat #B106 | |
| Chemical compound, drug | CNQX | Abcam | Cat #Ab1200017 | |
| Chemical compound, drug | D-AP5 | Abcam | Cat #Ab120003 | |
| Chemical compound, drug | Picrotoxin | Abcam | Cat #Ab120315 | |
| Commercial assay or kit | Pierce BCA Protein assay | Thermo Fisher Scientific | #23225 | |
| Other | High capacity Neutravidin-conjugated beads | Thermo Fisher Scientific | #29202 | |
| Other | Glutathione Sepharose | GE Healthcare | #17075601 | |
| Other | Lipofectamine 2000 | Thermo Fisher Scientific | #11668030 | |
| Software, algorithm | ImageJ Fiji | Schindelin et al., 2012; Schneider et al., 2012 | (RRID:SCR_003070) | |
| Software, algorithm | Clampfit 10 | Molecular Devices | RRID:SCR_011323 | |
| Software, algorithm | Axograph X version 1.6.4 | AxoGraph Scientific | https://axograph.com/ | |
| Software, algorithm | Prism version 8 | GraphPad | RRID:SCR_002798 | |
| Cell line (H. sapiens) | HEK293T | ATCC | Cat #CRL-3216 (RRID:CVCL_0063) | The identity of the cell line used in this study was authenticated by ATCC using STR profiling and was found to be an exact match to CRL-3216 (HEK293T) in the ATCC STR database. The cells have been tested for mycoplasma nd are negative. |
| Cell line (H. sapiens) | AAV-Pro HEK293T | Takara Bio | Cat #632273 |