Antibodies |
|
|
Anti-mouse CD11c clone N148 APC-Cy7 |
Biolegend |
Cat#117324; RRID: AB_830649 |
Anti-mouse CD11b clone M1/70 PE-Cy7 |
Biolegend |
Cat#101216; RRID: AB_312799 |
Anti-mouse XCR1 clone ZET PerCP-Cy5.5 |
Biolegend |
Cat#148208; RRID: AB_2564364 |
Anti-mouse I-A/I-E clone M5/114.15.2 APC |
Biolegend |
Cat#107614; RRID: AB_313329 |
Anti-mouse CD40 clone 3/32 PerCP-Cy5.5 |
Biolegend |
Cat#124624; RRID: AB_2561474 |
Anti-mouse CD80 clone 16-10A1 APC |
Biolegend |
Cat#104714; RRID: AB_313135 |
Anti-mouse CD86 clone GL-1 PE |
Biolegend |
Cat#105008; RRID: AB_313151 |
Anti-mouse B220 clone RA3-6B2 BV510 |
Biolegend |
Cat#103248; RRID: AB_2650679 |
Anti-mouse PD-L1 clone 10F.9G2 BV421 |
Biolegend |
Cat#124315; RRID: AB_10897097 |
Anti-mouse CCR7 clone 4B12 BV421 |
Biolegend |
Cat#120120; RRID: AB_2561446 |
Anti-mouse CD8 clone 53-6.7 APCcy7 |
Biolegend |
Cat#100714; RRID: AB_312753 |
Anti-mouse CD44 clone IM7 PerCPcy5.5 |
Biolegend |
Cat#103032; RRID: AB_2076204 |
Anti-mouse CD3 clone 17-A2 Pacific Blue |
Biolegend |
Cat#100214; RRID: AB_493645 |
H2Kb SIINFEKL tetramer PE |
NIH Tetramer Core Facility |
https://tetramer.yerkes.emory.edu/reagents/class-I-mhc |
Anti-mouse CD40 |
BioXcell |
Cat#BE0016-2; RRID: AB_1107647 |
Anti-phosphoAKT |
Cell Signaling |
Cat#9271S; RRID: AB_329825 |
Anti-phosphoAKT |
Cell Signaling |
Cat#4060S; RRID: AB_2315049 |
Anti-ERK1/2-Total |
Biolegend |
Cat# 686902; RRID: AB_2629535 |
Anti-phosphoERK1/2 |
Cell Signaling |
Cat#9101S; RRID: AB_331646 |
Anti-GAPDH-HRP |
Invitrogen |
Cat#MA5-15738-HRP; RRID: AB_2537659 |
Anti-p38 MAPK |
Cell Signaling |
Cat#8690S; RRID: AB_10999090 |
Anti-phosphop38 MAPK |
Cell Signaling |
Cat#4511S; RRID: AB_2139682 |
Anti-STAT3 |
Cell Signaling |
Cat#4904S; RRID: AB_331269 |
Anti-phosphoStat3 (Tyr705) (D3A7) |
Cell Signaling |
Cat#9145S; RRID: AB_2491009 |
Anti-Rabbit IgG H&L (HRP) |
Abcam |
ab7090; RRID: AB_955417 |
Anti-Rat IgG H&L (HRP) |
Abcam |
ab97057; RRID: AB_10680316 |
Bacterial and Virus Strains |
|
|
Listeria monocytogenes-expressing ovalbumin |
Ross Kedl |
N/A |
Biological Samples |
|
|
Murine lymph nodes |
This paper |
N/A |
Murine skin |
This paper |
N/A |
Murine bone marrow |
This paper |
N/A |
Chemicals, Peptides, and Recombinant Proteins |
|
|
Fluorescein isothiocyanate isomer 1 |
Sigma-Aldrich |
Cat#F7250 |
polyI:C |
Invivogen |
Cat#Vac-PIC |
Recombinant Murine Exodus-2 (CCL21) |
Peprotech |
Cat#250-13 |
Recombinant Murine MIP-3β (CCL19) |
Peprotech |
Cat#250-27B |
Recombinant Murine SDF-1β (CXCL12) |
Peprotech |
Cat#250-20B |
Sphingosine-1-phosphate |
R&D Systems |
Cat#1370/1 |
Ghost Dye Red 780 |
Tonbo Biosciences |
Cat#13-0865 |
Violet proliferation dye |
BD Biosciences |
Cat#562158 |
Critical Commercial Assays |
|
|
IP-One Gq kit |
Cis-Bio |
Cat#62IPAPEB |
MojoSort Mouse CD8 T Cell Isolation Kit |
Biolegend |
Cat#480008 |
F-actin Visualization Biochem Kit (fluorescence format) |
Cytoskeleton Inc. |
Cat#BK005 |
Experimental Models: Organisms/Strains |
|
|
Mouse: Pdl1−/−: CD274 KO (C57BL/6) |
Mayo Clinic |
N/A |
Mouse: OT1: C57BL/6-Tg(TcraTcrb) 1100Mjb/J |
Jackson Labs |
JAX: 003831 |
Mouse: WT: C57BL/6 |
Charles River Labs |
C57BL/6 (B6) Mouse Inbred 027 |
Mouse: Pdl1CyMt: CD274(TSS277-279AAA) |
Regional Mouse Genomics Core at National Jewish Health, This paper |
N/A |
Oligonucleotides |
|
|
Mm_Rn18s_3_SG QuantiTect Primer Assay |
QIAGEN |
Cat#QT02448075 |
Mm_Ccr7_1_SG QuantiTect Primer Assay |
QIAGEN |
Cat#QT00240975 |
Guide RNA: ACAAGCTCAAAAAACCGAAA TGG
|
Synthego |
N/A |
Recombinant DNA |
|
|
ssDNA HDR template: TTAAGATTGATTTCTTCTTCTTTAGTGAGAATGCTAGATGTGGAGAAATGTGGCGTTGAAGATgctgcagccAAAAACCGAAATGGTAAGTGTGAGTAACGAGGGAGGGGCAAGCCGAGGGAATGAGTGGGACA. |
IDT |
N/A |
Software and Algorithms |
|
|
Prism Version 8 |
Graphpad |
https://www.graphpad.com/scientific-software/prism/ |
CRISPOR |
Jean-Paul Concordet and Macimilian Haeussler |
http://crispor.tefor.net/ |
GPP sgRNA Designer: CRISPRko |
Broad Institute |
https://portals.broadinstitute.org/gpp/public/analysis-tools/sgrna-design |
FlowJo |
Becton, Dickinson and Company |
https://www.flowjo.com/ |