Appendix 1—key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Genetic reagent (M. musculus) | Kxd1-KO | Prepared in our lab (Yang et al., 2012) | ||
| Genetic reagent (M. musculus) | pa | The Jackson Laboratory | JAX: 000024; RRID:IMSR_JAX:000024 | |
| Genetic reagent (M. musculus) | Alb-Cre | Model animal research center of Nanjing university | RRID:IMSR_JAX:003574 | Derived from The Jackson Laboratory |
| Genetic reagent (M. musculus) | loxp | Prepared in our lab (Zhang et al., 2014) | ||
| Genetic reagent (M. musculus) | Bloc1s1-cKO | This paper | ||
| Strain, strain background (Escherichia coli) | BL21(DE3) | Vazyme | C504 | Chemical competent cells |
| Strain, strain background (Escherichia coli) | DH5α | Vazyme | C502 | Chemical competent cells |
| Cell line (Homo-sapiens) | Hep G2 | Cell bank of Chinese Academy of Sciences (Shanghai, China) | Cat#TCHu72; RRID:CVCL_0027 | Has been authenticate by STR profiling and tested negative for mycoplasma in cell bank |
| Cell line (Homo-sapiens) | HEK293T | Cell bank of Chinese Academy of Sciences (Shanghai, China) | Cat#GNHu17; RRID:CVCL_0063 |
Has been authenticate by STR profiling and tested negative for mycoplasma in cell bank |
| Biological sample (M. musculus) | Primary mouse hepatocytes | This paper | Freshly isolated from mouse liver | |
| Antibody | Mouse monoclonal anti-alpha Tubulin (clone DM1A) | Abcam | Cat#ab7291;RRID:AB_2241126 | IF (1:500) |
| Antibody | Rabbit polyclonal anti-alpha Tubulin | Abcam | Cat#ab18251; RRID:AB_2210057 | IF (1:1000) |
| Antibody | Rabbit polyclonal anti-Transferrin Receptor | Abcam | Cat#ab84036; RRID:AB_10673794 | IF (1:200), WB (1:2000) |
| Antibody | Rabbit polyclonal anti-LDL Receptor | Abcam | Cat#ab30532; RRID:AB_881272 | WB (1:2000) |
| Antibody | Rabbit monoclonal anti-LDL Receptor (clone EP1553Y) | Abcam | Cat#ab52818; RRID:AB_881213 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-PCSK9 | Abcam | Cat#ab31762; RRID:AB_777140 | WB (1:1000) |
| Antibody | Goat polyclonal anti-HA tag antibody | Abcam | Cat#ab9134; RRID:AB_307035 | IF (1:1000), WB (1:5000) |
| Antibody | Rat monoclonal anti-mouse IgG for IP (HRP) | Abcam | Cat#ab131368; N/A | WB (1:5000) |
| Antibody | Donkey anti-rabbit Alexa Fluor 405 | Abcam | Cat#ab175649; AB_2715515 | IF (1:1000) |
| Antibody | Mouse monoclonal anti-EEA1 (clone 14) | BD | Cat#610457; RRID:AB_397830 | IF (1:500) |
| Antibody | Mouse monoclonal anti-Cytochrome C (clone 6H2.B4) | BD | Cat#556432; RRID:AB_396416 | IF (1:250) |
| Antibody | Mouse monoclonal anti-CD63 (clone H5C6) | BD | Cat#556019; RRID:AB_396297 | IF (1:200) |
| Antibody | Goat polyclonal anti-mouse LDL Receptor | R and D | Cat#AF2255; RRID:AB_355203 | IF (1:100) |
| Antibody | Goat polyclonal anti-human LDL Receptor | R and D | Cat#AF2148; RRID:AB_2135126 | IF (1:100) |
| Antibody | Mouse monoclonal anti-beta Actin (clone AC-15) | Sigma-Aldrich | Cat#A5441; RRID:AB_476744 | WB (1:50000) |
| Antibody | Mouse monoclonal ant-Acetylated Tubulin antibody (clone 6-11B-1) | Sigma-Aldrich | Cat#T7451; RRID:AB_609894 | IF (1:200) |
| antibody | Mouse monoclonal anti-FLAG tag antibody (clone M2) | Sigma-Aldrich | Cat#F3165; RRID:AB_259529 | IF (1:1000), WB (1:5000) |
| Antibody | Rabbit polyclonal anti-FLAG tag antibody | Sigma-Aldrich | Cat#F7425; RRID:AB_439687 | IF (1:1000) |
| Antibody | Rat monoclonal anti-Tyrosinated Tubulin antibody (clone YL1/2) | Millipore | Cat#MAB1864; RRID:AB_2210391 | IF (1:200) |
| Antibody | Rabbit monoclonal anti-KIF3A antibody (clone D7G3) | Cell Signaling Technology | Cat#8507; RRID:AB_11141049 | WB (1:1000) |
| Antibody | Rabbit polyclonal anti-KIF13A antibody | Bethyl Laboratories | Cat#A301-077A; RRID:AB_873053 | WB (1:1000) |
| Antibody | Rabbit polyclonal anti-Myc tag antibody | MBL | Cat#562; RRID:AB_591105 | IF (1:500) |
| Antibody | Mouse monoclonal anit-Myc tag antibody (clone Myc3) | MBL | Cat#M192-3S; RRID:AB_11161202 | IF (1:500), WB (1:2000) |
| Antibody | Mouse monoclonal anti-HA tag antibody (clone F-7) | Santa Cruz | Cat#sc-7392; RRID:AB_627809 | IF (1:100) |
| Antibody | Mouse monoclonal anti-GST antibody (clone B-14) | Santa Cruz | Cat#sc-138; RRID:AB_627677 | WB (1:5000) |
| Antibody | Rabbit polyclonal anti-Pallidin antibody | Proteintech | Cat#10891–2-AP; RRID:AB_2164174 | WB (1:2000) |
| Antibody | Rabbit polyclonal anti-Dysbindin antibody | Prepared in our lab Wang et al., 2014 | N/A | WB (1:20000) |
| Antibody | Donkey anti-mouse Alexa Fluor 488 | ThermoFisher | Cat#A-21202; RRID:AB_141607 | IF (1:1000) |
| Antibody | Donkey anti-mouse Alexa Fluor 594 | ThermoFisher | Cat#A-21203; RRID:AB_2535789 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit Alexa Fluor 488 | ThermoFisher | Cat#A-21206; RRID:AB_2535792 | IF (1:1000) |
| Antibody | Donkey anti-Rabbit Alexa Fluor 594 | ThermoFisher | Cat#A-21207; RRID:AB_141637 | IF (1:1000) |
| Antibody | Donkey anti-Goat Alexa Fluor 488 | ThermoFisher | Cat#A-11055; RRID:AB_2534102 | IF (1:1000) |
| Antibody | Donkey anti-Goat Alexa Fluor 594 | ThermoFisher | Cat#A-11058; RRID:AB_2534105 | IF (1:1000) |
| Recombinant DNA reagent | BLOS1-GFP-C2 (plasmid) | This paper | ||
| Recombinant DNA reagent | BLOS1-GFP-N2 | This paper | ||
| Recombinant DNA reagent | BLOS1-FLAG | This paper | ||
| Recombinant DNA reagent | BLOS1-Myc | This paper | ||
| Recombinant DNA reagent | BLOS1-HA | This paper | ||
| Recombinant DNA reagent | GST-BLOS1 | This paper | ||
| Recombinant DNA reagent | RAB11A-GFP-C2 | This paper | ||
| Recombinant DNA reagent | RAB11A-Scarlet-C2 | This paper | ||
| Recombinant DNA reagent | KIF13A-FLAG | This paper | ||
| Recombinant DNA reagent | KIF13A-GFP-N2 | This paper | ||
| Recombinant DNA reagent | KIF13A-ST-GFP-N2 | This paper | ||
| Recombinant DNA reagent | KIF13A-HA | This paper | ||
| Recombinant DNA reagent | KIF13A-R-HA | This paper | ||
| Recombinant DNA reagent | KIF13A-R-Scarlet-N2 | This paper | ||
| Recombinant DNA reagent | KIF3B-Myc | This paper | ||
| Recombinant DNA reagent | KIF3B-R-Myc | This paper | ||
| Recombinant DNA reagent | KIF3B-R-Scarlet-N2 | This paper | ||
| Recombinant DNA reagent | KIF3A-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3A-R-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3C-HA | This paper | ||
| Recombinant DNA reagent | KIF3C-R-HA | This paper | ||
| Recombinant DNA reagent | KAP3-HA | This paper | ||
| Recombinant DNA reagent | KIF5B-R-Myc | This paper | ||
| Recombinant DNA reagent | KIF16B-FLAG | This paper | ||
| Recombinant DNA reagent | KIF3A-FLAG-KIF3B-Myc-BLOS1-HA | This paper | ||
| Sequence-based reagent | LDLR_1F | This paper | RT-PCR primers | GTCTTGGCACTGGAACTCGT |
| Sequence-based reagent | LDLR_1R | This paper | RT-PCR primers | CTGGAAATTGCGCTGGAC |
| Sequence-based reagent | LDLR-2F | This paper | RT-PCR primers | ACGGCGTCTCTTCCTATGACA |
| Sequence-based reagent | LDLR-2R | This paper | RT-PCR primers | CCCTTGGTATCCGCAACAGA |
| Sequence-based reagent | GAPDH-F | This paper | RT-PCR primers | GGAGCGAGATCCCTCCAAAAT |
| Sequence-based reagent | GAPDH-R | This paper | RT-PCR primers | GGCTGTTGTCATACTTCTCATGG |
| Sequence-based reagent | KIF13A-R-F | This paper | Site-directed mutagenesis primers | GAGCCTGGTAGACCTGGCGGCGAGCGAGAGAGTGTCGAAGAC |
| Sequence-based reagent | KIF13A-R-R | This paper | Site-directed mutagenesis primers | GTCTTCGACACTCTCTCGCTCGCCGCCAGGTCTACCAGGCTC |
| Sequence-based reagent | KIF3B-R-F | This paper | Site-directed mutagenesis primers | CTGAATCTTGTAGATCTTGCTGCCAGTGAGCGGCAAGCCAAG |
| Sequence-based reagent | KIF3B-R-R | This paper | Site-directed mutagenesis primers | CTTGGCTTGCCGCTCACTGGCAGCAAGATCTACAAGATTCAG |
| Sequence-based reagent | KIF3C-R-F | This paper | Site-directed mutagenesis primers | GTAGACCTGGCCGCCAGTGAGAGACAG |
| Sequence-based reagent | KIF3C-R-R | This paper | Site-directed mutagenesis primers | CTGTCTCTCACTGGCGGCCAGGTCTAC |
| Sequence-based reagent | KIF5B-R-F | This paper | Site-directed mutagenesis primers | CTGGTTGATTTAGCTGCTAGTGAAAAGGTTAG |
| Sequence-based reagent | KIF5B-R-R | This paper | Site-directed mutagenesis primers | CTAACCTTTTCACTAGCAGCTAAATCAACCAG |
| Sequence-based reagent | MfeI-F | This paper | Site-directed mutagenesis primers for pSilencer 5.1-H1 Retro vector | ATGGAGGACCCCAATGCCAAGG |
| Sequence-based reagent | MfeI-R | This paper | Site-directed mutagenesis primers for pSilencer 5.1-H1 Retro vector | CCGAGTGGCTGTGGCTTCC |
| Sequence-based reagent | BLOS1-1F | This paper | shRNA template primers | gatccgTCGGAATGGTGGAGAACTTgagaAAGTTCTCCACCATTCCGAttttttggaaa |
| Sequence-based reagent | BLOS1-1R | This paper | shRNA template primers | agcttttccaaaaaaTCGGAATGGTGGAGAACTTtctcAAGTTCTCCACCATTCCGAcg |
| Sequence-based reagent | BLOS1-2F | This paper | shRNA template primers | gatccGCACTGGAATATGTCTACAgagaTGTAGACATATTCCAGTGCttttttggaaa |
| Sequence-based reagent | BLOS1-2R | This paper | shRNA template primers | agcttttccaaaaaaGCACTGGAATATGTCTACAtctcTGTAGACATATTCCAGTGCg |
| Sequence-based reagent | BLOS1-3F | This paper | shRNA template primers | gatccgCAGAAGCTTTGGTGGATCAgagaTGATCCACCAAAGCTTCTGttttttggaaa |
| Sequence-based reagent | BLOS1-3R | This paper | shRNA template primers | agcttttccaaaaaaCAGAAGCTTTGGTGGATCAtctcTGATCCACCAAAGCTTCTGcg |
| Sequence-based reagent | KIF13A-1F | This paper | shRNA template primers | cggGGAAACCTCCCAAGGTATTTGgagaCAAATACCTTGGGAGGTTTCCtttttga |
| Sequence-based reagent | KIF13A-1R | This paper | shRNA template primers | agcttCAAAAAGGAAACCTCCCAAGGTATTTGtctcCAAATACCTTGGGAGGTTTCC |
| Sequence-based reagent | KIF13A-2F | This paper | shRNA template primers | ccggTTAACGAACTTCTGGTTTATTgagaAATAAACCAGAAGTTCGTTAAtttttga |
| Sequence-based reagent | KIF13A-2R | This paper | shRNA template primers | agcttCAAAAATTAACGAACTTCTGGTTTATTtctcAATAAACCAGAAGTTCGTTAA |
| Sequence-based reagent | KIF3A-1F | This paper | shRNA template primers | ccggCGTCAGTCTTTGATGAAACTAgagaTAGTTTCATCAAAGACTGACGtttttga |
| Sequence-based reagent | KIF3A-1R | This paper | shRNA template primers | agcttCAAAAACGTCAGTCTTTGATGAAACTAtctcTAGTTTCATCAAAGACTGACG |
| Sequence-based reagent | KIF3A-2F | This paper | shRNA template primers | ccggGCCTGTTTGAACACATTCTAAgagaTTAGAATGTGTTCAAACAGGCtttttga |
| Sequence-based reagent | KIF3A-2R | This paper | shRNA template primers | agcttCAAAAAGCCTGTTTGAACACATTCTAAtctcTTAGAATGTGTTCAAACAGGC |
| Sequence-based reagent | KIF3A-3F | This paper | shRNA template primers | ccggCGGGATTATCAGGAAATGATTgagaAATCATTTCCTGATAATCCCGtttttga |
| Sequence-based reagent | KIF3A-3R | This paper | shRNA template primers | agcttCAAAAACGGGATTATCAGGAAATGATTtctcAATCATTTCCTGATAATCCCG |
| Peptide, recombinant protein | Streptavidin | Thermo Fisher | Cat. #: 434302 | |
| Commercial assay or kit | iScript cDNA Synthesis Kit | BIO-RAD | 1708891 | |
| Commercial assay or kit | RNeasy Mini Kit | QIAGEN | 74104 | |
| Commercial assay or kit | ClonExpress II One Step Cloning Kit | Vazyme | C112 | |
| Chemical compound, drug | Puromycin | InvivoGen | ant-pr-1 | |
| Chemical compound, drug | Leupeptin | Sigma-Aldrich | L5793 | |
| Chemical compound, drug | Oil Red O | Sigma-Aldrich | O9755 | |
| Chemical compound, drug | Sudan Black B | Sigma-Aldrich | 199664 | |
| Chemical compound, drug | 1,1’-Dioctadecyl-3,3,3’,3’-tetramethylindocarbocyanine perchlorate (DiI) | Sigma-Aldrich | 42364 | |
| Software, algorithm | Fiji | http://fiji.sc/; Schindelin et al., 2012 | RRID:SCR_002285 | Version 2.0.0-rc-69/1.52 n |
| Other | Minimal Essential Medium (MEM) | GE Healthcare | SH30024.01 | |
| Other | Glutathione Sepharose 4B resin | GE Healthcare | 17075601 | |
| Other | Collagen, Type I | Sigma-Aldrich | C3867 | |
| Other | Collagenase, TypeIV | Sigma-Aldrich | C5138 | |
| Other | Anti-FLAG M2 affinity gel | Sigma-Aldrich | A2220 | |
| Other | Phalloidin Alexa Fluor 594 | ThermoFisher | A12381 | |
| Other | Prolong Gold Antifade Mountant | ThermoFisher | P36935 | |
| Other | Lipofectamine 3000 | ThermoFisher | L3000015 | |
| Other | Sodium pyruvate | ThermoFisher | 11360070 | |
| Other | MEM Non-Essential Amino Acids | ThermoFisher | 11140050 | |
| Other | Tubulin Tracker Deep Red | ThermoFisher | T34076 | |
| Other | jetPEI-Hepatocyte | Polyplus | 102–05N |
Note: The listed references in this table can be referred to the reference list in main text.