Morphologic, molecular, and pathogenic characterization of Phytophthora palmivora isolates causing flower rot on azalea

Abstract

The objective of this work was to characterize two Phytophthora palmivora isolates causing floral blight and rot in azalea plants and to evaluate the pathogenicity of this oomycete pathogen on several plant species. Azalea plants with symptoms of flower blight and rot were obtained in the municipality of Holambra-SP. After an attempt of isolation, colonies with Phytophthora characteristics grown only on selective V8 medium. Molecular identification of the isolates was done by amplification and sequencing of ITS and COX2 regions. In the phylogenetic analysis, the azalea isolates clustered with reference isolates of P. palmivora. Morphological characteristics were similar to those described for P. palmivora. Isolates were inoculated in healthy azalea plants and caused leaf blight and floral rot. The pathogen was re-isolated from symptomatic plants completing Koch’s postulates. In a host range test, the azalea isolates were able to cause lesions on leaves of vinca, snapdragon, basil, and tomato, and affected both leaves and flowers of geranium. Fruit rot was observed on tomato, potato, sweet pepper, scarlet eggplant, zucchini, cucumber, maroon cucumber, onion, apple, papaya, guava, and carrot. This is the first report of the species P. palmivora causing flower blight and rot in azalea plants in Brazil and probably in the world.

Introduction

In Brazil, the segment of flowers and ornamental plants was responsible for one amount of about U$ 7.0 billion in 2017 [1]. The Southeastern region leads the producing ranking in the country, and São Paulo is the main flower producer and market, with a participation of around 53% in national production [2]. In São Paulo State stands out the Holambra Count, that produces and exports its exceeding production to other Brazilian states.

Among the main species of ornamental plants produced and marketed in Brazil, there are some potted flowers such as chrysanthemum, orchids, kalanchoe, begonias, and azaleas [3]. Azaleas are plants of the Ericaceae family, originated from Southeast Asia, specifically China. These ornamental plant species are widespread in world because of its colorful flowers ranging from white, red, pink, and sometimes striped. They may be found in gardens and interior decoration in Brazil [4].

Several species of pathogens are associated with ornamental plants, causing diseases and economic losses, especially when they reach the aerial organs, which are the main tradable part in this industry. Plants belonging to the family Ericaceae, as the one from the genus Rhododendron, are affected by several species of Phytophthora [5–7]. Despite this, the oomycete Phytophthora palmivora [(Butler) Butler 1919)] has not yet been reported as a pathogen of azalea (Rhododendron simsii Planch.).

The species P. palmivora is a cosmopolitan plant pathogen that can survive in the soil for a long time and affects different plant tissues such as roots, stems, flowers, leaves, and fruits [5, 8]. This oomycete species presents a large number of hosts, including forest plants, ornamental, and fruit trees [5, 9, 10]. In Brazil, this pathogen has been reported causing diseases in dozens of host species, but it is not common on ornamental plants [11].

Traditionally, the identification of Phytophthora species have been based on morphological features of the reproductive and asexual structures and compared with taxonomic keys [5, 12]. In the last years, the advance in the use of molecular markers has optimized the identification of these species and allowed a better understanding of the evolutionary relations within the genus. Among the markers, the internal transcribed spacer (ITS) region [13–15] or mitochondrial genes as cytochrome c oxidase subunit II (COX2) [16, 17] are common for identification and phylogenetic analysis. The first comprehensive study of a wide range of species in the genus was reported by Cook et al. [18] using the ITS region to examine the phylogenetic relationship among 50 species. A total of eight primary clades were identified with two additional clades, 9 and 10. A phylogenetic study was conducted using several nuclear DNA loci, including the ITS region. In this study, the the genus Phytophthora was divided into ten different clades that, until today, are reference in phylogenetic studies within this genus [19]. More recently, in a work done by Martin et al. [20], 4 mitochondrial genes and 7 nuclear genes of 107 species provided 10 clades, almost identical to Blair et al.’s [19] study. In these works, it was possible to group the species according to the morphology of sporangia.

The objective of this work was to characterize two Phytophthora isolates causing a floral blight and rot in azalea and to evaluate the pathogenicity of this oomycete on several species of plants.

Material and methods

Pathogen isolates and their identification

Plants of azalea, imported from the municipality of Holambra-SP, presenting symptoms of flower blight and rot, were collected in a floriculture in Taguatinga-DF. For pathogen isolation, flower fragments with symptoms were superficially disinfested and deposited in potato dextrose agar media (PDA) + tetracycline (50 ppm) and selective V8 BARPN (benomyl, ampicillin, rifampicine, PCNB, and nystatin). Plates were maintained in a BOD incubator at 25 °C and 12 h of light for 3 days. After this incubation period, colonies with Phytophthora characteristics were only present in V8 selective medium. In this way, two isolates of the pathogen were collected from flowers of two different plants. For molecular identification of the Phytophthora species, DNA extraction of the two isolates was performed according to the method described by Mahuku [21]. Two genomic regions were chosen for this identification process, ITS using ITS4 (5′ TCCTCCGCTTATTGATATGC 3′) and ITS5 (5′ GGAAGTAAAAGTCGTAACAAGG 3′) primers for amplification of the ribosomal DNA ITS1, ITS2 and 5.8S regions and COX2 with primers cox2-F (5′ GGCAAATGGGTTTTCAAG ATCC 3′) e cox2-R (5′ CCATGATTAATACCACAAATTTCACTAAC 3′) [22].

The PCR product observed on gel was purified with a PureLink Quick Gel Extraction Kit (Invitrogen, Waltham–MA) and subjected to direct sequencing in Macrogen (South Korea). The ITS and COX2 sequences were compared to sequences available in GenBank and deposited in this database with the access numbers described in Table 1.

Table 1.

List of accessions from species of Phytophthora and Pythium used for the phylogenetic analysis of ITS and COX2 regions. Accessions identified as the same species are not obligatory from the same isolate

Phythophthora species	Name of Isolate	Host	Location of origin	Genbank accession
				ITS–rDNA	COX2
Phytophthora agathidicida	ICMP 19450		New Zealand	KP295314
Phytophthora alticola	CMW 19425		South Africa	DQ988196
Phytophthora andina	EC3363		Ecuador	AY770741
Phytophthora arenaria	CBS 125800		Australia	HQ013215
Phytophthora arenaria	CBS 127950		Australia	HQ013219
Phytophthora bisheria	P1.33		USA	AF408625.2
Phytophthora bisheria	CBS 25393		Netherlands	DQ302411
Phytophthora botryosa	IMI136915	Hevea brasilensis	Malaysia	AF266784
Phytophthora botryosa	P6945		Malaysia	HQ261507
Phytophthora botryosa	P3425		Malaysia	HQ261509
Phytophthora cactorum	CH98PEC1			AB217671
Phytophthora cactorum	IMI296524	Rubus idaeus	Wales	AF266772
Phytophthora capensis	P1822			GU191219
Phytophthora capsici	IFO30696			AB217670
Phytophthora capsici	IMI352321	Piper nigrum	India	AF266787
Phytophthora castaneae	ICMP 19450		Taiwan	KP295323
Phytophthora castaneae	ICMP 18737		Taiwan	KP295324
Phytophthora citrophthora	IMI332632	Actinidia chinensis	Chile	AF266785
Phytophthora citrophthora	CBS95087		USA	HQ643205
Phytophthora citrophthora	CBS111339		South Korea	HQ643207
Phytophthora clandestina	CLA2		Australia	AJ131989
Phytophthora cocois	ICMP 19685		Cote d’Ivoire	KP295306
Phytophthora colocasiae	IMI368918	Colocasia esculenta	Malaysia	AF266786
Phytophthora elongata	VHS15078		Australia	GQ847755
Phytophthora frigida	CMW19435		South Africa	DQ988177
Phytophthora glovera	11,091		Brazil	AF279127.2
Phytophthora glovera	11,095		Brazil	AF279128
Phytophthora hedraiandra	CBS 111725			AY707987
Phytophthora heveae	IMI180616	Hevea brasiliensis	Malaysia	AF266770
Phytophthora heveae	ICMP 19453		USA	KP295301
Phytophthora himalsilva	44		Nepal	HM752784
Phytophthora idaei	IDA3			AF266773
Phytophthora ilicis	ILI1 (P590)		UK	AJ131990
Phytophthora infestans	IMI66006	Solanum tuberosum	Netherlands	AF266779
Phytophthora infestans	P12022		Russia	HQ261588
Phytophthora ipomoeae	Pic99165			AY770742
Phytophthora iranica	IRA1 (IMI158964)		Iran	AJ131987
Phytophthora katsurae	IMI360596	Cocos nucifera	Ivory Coast	AF266771
Phytophthora litchi	TARI 20250		Taiwan	JQ814693
Phytophthora meadii			Taiwan	AY251649
Phytophthora megakarya	IMI337104	Theobroma cacao	Ghana	AF266782
Phytophthora mengei	42B2			EU748545
Phytophthora mexicana	P0646		Mexico	HQ261620
Phytophthora mirabilis	CBS67885			AF266777
Phytophthora multivesiculata	CBS545.96	Cymbidium	Netherlands	AF266790
Phytophthora multivora	DDS1450		Australia	FJ237515.2
Phytophthora multivora	CBS 124094		Australia	FJ237521.2
Phytophthora nemorosa	2055.2		USA	AY332654
Phytophthora nicotianae	Phkq1			AB217682
Phytophthora nicotianae	UQ848		Australia	AF266776
Phytophthora occultans	CBS 101557		Netherlands	JX978155
Phytophthora pachypleura	BH-2013		UK	KC855330
Phytophthora palmivora	UQ1294	Theobroma cacao	Papua New Guinea	AF266780
Phytophthora palmivora	P6390		Indonesia	HQ261633
Phytophthora palmivora	CBS27433		Cyprus	HQ643308
Phytophthora palmivora	PHY02			KT175509
Phytophthora palmivora	2713	Rododendron simsii	Brazil	MK932672	MK937526
Phytophthora palmivora	2714	Rododendron simsii	Brazil	MK932673	MK937525
Phytophthora phaseoli	CBS55688			AF266778
Phytophthora pini	16A8		USA	GQ324989
Phytophthora plurivora	CBS 124089		Germany	FJ665225
Phytophthora plurivora	CBS 124089		Italy	FJ665227
Phytophthora pluvialis	LC		USA	KC529657
Phytophthora pseudosyringae	PSEU 6			AY230190
Phytophthora pseudosyringae	PSEU 12			AY242980
Phytophthora pseudotsugae	IMI331662	Pseudotsuga menziesil	USA	AF266774
Phytophthora psychrophila	IFB	Querus robur	Germany	AF449494
Phytophthora quercetorum	MD 9/2		USA	DQ313223
Phytophthora quercina	IFB		Germany	AJ131986
Phytophthora siskiyouensis	9585.2		USA	EF490682
Phytophthora stricta	58A2			KF192695
Phytophthora tentaculata	CBS55296	Chrysanthemum leucanthemum	Germany	AF266775
Phytophthora terminalis	PD4885512		Netherlands	JX978167
Phytophthora tropicalis	H352(A2)			AY208125
Pythium undulatum	IMI337230	Larix sp.	Scotland	AF271230
Phytophthora acerina	B057		Italy		JX951285
Phytophthora andina	P13365	Solanum brevifolium	Ecuador		GU318297
Phytophthora cactorum	P6625	Fragaria s.	Taiwan		JF771401
Phytophthora cactorum	P7014	Syringa vulgaris	The Netherlands		GU221951
Phytophthora cajani	P3105	Cajanus cajani	Índia		GU221954
Phytophthora cambivora	P0592	Abies procera	USA		JF771263
Phytophthora cinnamomi	P2110	Cinnamomum burmannii	West Sumatra		JF771337
Phytophthora cinnamomi var. parvispora	P8495	Beaucamea sp.	Germany		GU221971
Phytophthora cinnamomi var. robiniae	P16350	Robinia pseudoacacia	China		JF771397
Phytophthora europaea	P10324	Quercus rhizosphere	France		GU222005
Phytophthora fragariae	P3821	Fragaria sp.	UK		JF771445
Phytophthora hedraiandra	P11056	Rhododendron sp.	USA		JF771449
Phytophthora heveae	P3428	Hevea brasiliensis	Malaysia		GU222027
Phytophthora hibernalis	P3822	Citrus sinensis	Australia		GU222029
Phytophthora idaei	P6767	Rubus idaeus	UK		GU222032
Phytophthora infestans	P10650	Solanum tuberosum	Mexico		GU318302
Phytophthora ipomoeae	P10225	Ipomoea longipedunculata	Mexico		GU222045
Phytophthora iranica	P3882	Solanum melongena	Iran		GU222048
Phytophthora katsurae	P10187	Castanea crenata	Japan		GU222049
Phytophthora megakarya	P8516	Theobroma cacao	São tome		GU222067
Phytophthora melonis	P10994	Trichosanthes dioica	Índia		JF771523
Phytophthora mirabilis	P3005	Mirabilis jalapa	Mexico		GU222077
Phytophthora multivesiculata	P10525	Cymbidium sp.	Netherlands		JF771529
Phytophthora multivesiculata	P10410	Cymbidium sp.	Netherlands		JF771528
Phytophthora multivesiculata	P10327	Cymbidium sp.	Netherlands		JF771527
Phytophthora nicotianae	P6303	Grammatophyllum sp.	Indonesia		GU318304
Phytophthora niederhauserii	P10617	Thuja occidentalis	USA		GU222092
Phytophthora palmivora	PI-5	Theobroma cacao	Brazil		AY129218
Phytophthora palmivora	P11007	Areca catechu	Guam		MH760260
Phytophthora palmivora	P0497	Theobroma cacao	Colombia		MH760254
Phytophthora palmivora	CBS 111346	Cymbidium sp.	South Korea		MH760267
Phytophthora palmivora	P16385	Howea forsteriana	USA		MH760259
Phytophthora phaseoli	P10145	Phaseolus lunatus	USA		GU222104
Phytophthora pistaciae	P6197	Pistacia vera	Iran		GU222109
Phytophthora pseudotsugae	P10339	Pseudotsuga menziesii	USA		GU222121
Phytophthora quercetorum	P15555	Quercus rubra rhizosphere	USA		GU222124
Phytophthora quercina	P10334	Quercus robur	Germany		GU222125
Phytophthora ramorum	P10301	Rhododendron sp.	Netherlands		GU222130
Phytophthora rubi	P3289	Rubus sp.	USA		GU222132
Phytophthora sojae	P3114	Glycine max	USA		GU222142
Phytophthora tentaculata	P8497	Chrysanthemum leucanthemum	Germany		GU222150
Phytophthora uliginosa	P10413				GU222156
Phytophthora uliginosa	P10328	Quercus robur rhizosphere	Germany		GU222155
Phytophthora uniformis	P16206	Alnus sp.	Sweden		JQ439404
Phytophthora vignae	P3019	Vigna unguiculata	Australia		GU222157
Pythium undulatum	P10342	Larix sp.	UK		JQ439490

The isolates were deposited in the Phytophthora Collection Arnaldo Medeiros of CEPEC/CEPLAC (Ilhéus-BA), under the numbers 02713 and 02714. The two isolates were cultured alone or paired with reference isolates of P. palmivora A1 and A2 mating types in clarified V8 culture medium and carrot-agar medium. Plates with the isolate colonies were kept in a BOD incubator at 25–27 °C under continuous light to induce the production of asexual reproductive structures for morphometric characterization. Among the evaluated characters are presence or absence of chlamydospores, sporangia mean of length and breadth and length/breadth ration, apical thickening of sporangia (papilla) and width of the exit pore, and caducity of sporangia and pedicel length average. For each isolate, 50 of these structures were randomly measured and the average of each attribute was considered for comparison with taxonomic keys. Disks of 5-day-old colonies on carrot-agar of each one of the azalea isolates were paired with standard A1 and A2 isolates of P. palmivora using the sandwich method [23] and kept in the dark at 25 °C for 5 days, aiming to know the mating type of each isolate and to obtain sexual reproductive structures for measurement. It was observed the antheridia type, the diameter of the oogonia, and the diameter and type of oospores. The characteristics analyzed were compared with the descriptions of the taxonomic key of Erwing and Ribeiro [5].

Phylogenetic analysis

The COX2 and ITS sequences were assembled and edited according to base pair quality as evaluated using the Lasergene Molecular Biology Package (DNAstar, Madison, WI, USA). Ambiguities and other errors were verified in the corresponding electropherograms and then removed and/or corrected manually. Preliminary identification of the organisms was performed using BLASTn tool in NCBI [24]. Due to the close identity of the isolates with P. palmivora, sequences of reference isolates of this genus were retrieved from the GenBank and Phytophthora-ID [25] (Table 1).

The alignments of COX2 and ITS were performed separately with the help of the MAFFT plugin [26] in Geneious Prime 2019 [27] with trimming performed to its extremities. For the phylogenetic analysis, best fit models were chosen for each region using Akaike information criterion with Mega X [28], resulting in GTR + G + I model for both COX2 and ITS. Phylogeny was performed separately for each genomic region in Mrbayes plugin [29], version 3.2.2, also in Geneious Prime 2019 with 2 million generations chain and burn-in of 25% [27].

Pathogenicity in azalea and host range characterization

To evaluate the range of hosts, several species of fruit, ornamental, and vegetables were tested. Depending on the plant organ to be inoculated, two different methods of inoculation were used, culture disc on detached fruits and spraying the aerial organs of the plant with a suspension of zoospores of the pathogen.

The first assay of pathogenicity was done in fruits and other organs of tomatoes (Solanum lycopersicon L.), potato (Solanum tuberosum L.), apple (Malus domestica L.), lemon [Citrus limon (L.) Osbeck], orange (Citrus sp.), maroon cucumber (Cucumis anguria L.), guava (Psidium guajava L.), papaya (Carica papaya L.), onion (Allium cepa L.), cucumber (Cucumis sativus L.), sweet pepper (Capsicum annuum L.), banana (Musa sp.), Zucchini (Cucurbita pepo L.), carrot (Daucus carota L.), and scarlet eggplant (Solanum aethiopicum L.). These fruits were washed and disinfested with 0.5% hypochlorite. The inoculation was performed by removing a disk of culture of 5 mm diameter containing active growing mycelium that was placed in contact with a wound caused by a sterilized entomological pin on the surface of the fruit. Three fruits were used for each isolate and two discs were deposited on opposite sides of each fruit. The fruits were then placed in a wet chamber at room temperature (23 to 28 °C). The evaluation was performed from the second to the fourth day, and consisted in observing the incidence of fruit or other organ with symptoms of rotting. As a control, discs of clarified V8 culture medium were placed in contact with the fruits surface. The re-isolation of the pathogen from symptomatic fruits was done in selective V8 media.

In the second pathogenicity test, aiming to evaluate the ability of the azalea isolates to infect the aerial part of ornamental plants and vegetables, the following species were tested: snapdragon (Antirrhinum majus L.), African violet (Saintpaulia ionantha J.C. Wendl), geranium (Pelargonium × hortorum L.H. Bailey), perpetual (Gomphrena globosa L.), vinca (Vinca rosea L.), basil (Ocimum basilicum L.), tomato (S. lycopersicum), and sweet pepper (C. annuum), while using azalea plants as positive control. The plants were transplanted into 2 L pots containing sterile soil. For inoculum preparation, the isolates were cultivated in clarified V8 culture medium and kept under continuous light for 7 days. After the sporangia formation, distilled water was added to the cultures, and the plates were kept in a refrigerator at 5 °C for 1 h. After this time, the plates remained at room temperature for 1 h. The zoospore suspension was filtered in double-layered gauze into a glass Becker. Then, the zoospores concentration of the suspension was estimated with a hemacytometer [30]. The inoculum concentration was adjusted to 1 × 10⁵ zoospores mL⁻¹ and was subsequently sprayed on the aerial part of the plants. These plants were maintained in wet chamber, made with plastic bags moistened internally and placed over the plants and around the vessels, for 24 h. After this, the plants were kept in greenhouse for the next 6 days. At the seventh day of inoculation, the disease incidence was evaluated in leaves and flowers. The pathogen was re-isolated from the symptomatic plants in selective V8 media.

Results

Two oomycete isolates were obtained from azalea plants with floral rot. The isolates were deposited in the CEPLAC Phytophthora culture collection under codes 02713 and 02714. BLASTn preliminary results indicated a close identity with several P. palmivora isolates, both for COX2 and ITS regions. The nucleotide identity of the ITS region was 100% and the COX2 was 99% with sequences of reference isolates of P. palmivora deposited on GenBank. The morphological and morphometric characteristics of the two isolates also corresponded to those described for the species P. palmivora [5] (Table 2). Both isolates produced oospores when paired with A2 standard isolates being identified as P. palmivora of the A1 mating type. Chlamydospores intercalary and terminal were seen.

Table 2.

Morphological characteristics of the Phytophthora palmivora isolates obtained from symptomatic azalea plants

Characteristic		Isolate
		02713	2714
Sporangium	La	26–13 (19.6)	24–14 (17.9)
	Cb	44–20 (36.8)	39–23 (30.5)
Sporangium C/L relation		1.8: 1	1.7: 1
Papilla depth		5.2–2.2 (3.08)	6.1–1.7 (3.15)
Apical pore openness		4.8–3.0 (3.68)	5.3–2.0 (3.98)
Pedicels length		2.8–1.8 (2.24)	3.3–1.3 (2.21)
Antheridia diameter		13–20 (15.92)	12–18 (15.06)
Oogonia diameter		21–29 (24.78)	17–32 (26.32)
Oospore diameter		19–26 (22.14)	22–27 (23.72)
Oosporo type		Aplerotic	Aplerotic
Antheridia insertion		Amphigynous	Amphigynous

Amplitude of the dimensions variation of each structure followed by the average between parentheses

^aL = Sporangium width

^bC = Sporangium length

Fragments of the ITS regions of rDNA and from the COX2 regions of mtDNA amplified from azalea Phytophthora sp. isolates presented 544 and 639 base pairs to isolate 02713 and 451 and 640 base pairs to 02714, respectively.

The Bayesian inference analyses of the single regions (ITS or COX2) displayed similar tree topologies with high posterior probability levels. For the COX2 region, both isolates grouped with other five P. palmivora, with a posterior probability of “1” (Fig. 1) clustering closer to accession AY129218, isolated from cacao (Theobroma cacao) while farther to other accessions originally isolated from Kentia palm (Howea forsteriana Bacc.), orchid (Cymbidium spp.), and palm tree (Areca catechu L.). For the ITS region, both isolates 02713 and 02714 clustered with other four P. palmivora accessions also with the maximum posterior probability value (Fig. 1).

Fig. 1.

Phylogenetic trees constructed by Bayesian inference using Mrbayes plugin in Geneious Prime 2019 with 2 million generations and 25% burnin. Model GTR + G + I chosen separately for each region in MEGA X using Akaike information criterion. a Phylogenetic tree of ITS region with accession AF281230 of Pythium undulatum as outgroup. b Phylogenetic tree of COX2 partial sequence with accession JQ439490 of Pythium undulatum as outgroup

After inoculation in healthy azalea plants, both isolates induced symptoms similar to those observed on the commercial plants, such as floral blight and rot, as well as leaf spots (Fig. 2a). Control plants not inoculated with the pathogen remained free of symptoms (Fig. 2b). An oomycete with morphological characteristics similar to P. palmivora was re-isolated from the symptomatic flowers in pure culture confirming the etiology of the disease. In the control plants, the pathogen re-isolation was negative.

Fig. 2.

Azalea plant showing symptoms of floral rot after inoculation with Phytophthora palmivora zoospores (a) and noninoculated control (b)

When inoculated in fruits, the P. palmivora isolates were able to cause lesions in scarlet eggplant, on tomato, potato, sweet pepper, guava, carrot, maroon cucumber, zucchini, cucumber, onion, apple, and papaya (Table 3). The isolates were not pathogenic to banana, lemon, and orange fruits. An illustration of the symptoms on some organs of the other hosts can be seemed in Fig. 3a–f.

Table 3.

Pathogenicity of Phytophthora palmivora isolates in different plant species by two methods of inoculation

Plant species	Inoculation method
	Fruit	Aerial part
Tomato	+	+
Potato	+	NA
Apple	+	NA
Lemon	−	NA
Orange	−	NA
Papaya	+	NA
Onion	+	NA
cucumber	+	NA
Sweet pepper	+	−
Banana	−	NA
Zucchini	+	NA
Maroon cucumber	+	NA
Guava	+	NA
Carrot	+	NA
Scarlet eggplant	+	NA
Azalea	NA	+
Vinca	NA	+
Snapdragon	NA	+
African violet	NA	−
Geranium	NA	+
Perpetual	NA	−
Basil	NA	+

−: No symptoms

NA not evaluated

Fig. 3.

Illustration of the symptoms in some plant species inoculated with Phytophthora palmivora isolates: a Scarlet eggplant (Solanum aethiopicum), b Tomato (Solanum lycopersicon), c Sweet pepper (Capsicum annuum), d Guava (Psidium guajava), e Carrot (Daucus carota), Maroom cucumber (Cucumis anguria), g Geranium (Pelargonium × hortorum), h Snapdragon (Antirrhinum majus), and i Vinca (Vinca rosea)

When the P. palmivora isolate was inoculated in the aerial part of the other testing plants, it was able to cause necrotic lesions on leaves of vinca, snapdragon, basil, and tomato, and affected both leaves and flowers of geranium (Table 3). The symptoms induced by the pathogen on flowers of geranium, snapdragon, and vinca can be seemed in Fig. 3g–i. The azalea plants used as positive control confirmed the pathogenicity of the isolate that is capable of affecting both leaves and flowers of this species.

An oomycete with the same morphological characteristics of the species P. palmivora was re-isolated from the symptomatic plants and fruits in both assays, but not from the controls.

Discussion

The morphological and morphometric characteristics of the two isolates corresponded to those described for the species P. palmivora [5] (Table 2). Both isolates produced oospores when paired with A2 standard isolates, but not with A1 isolates and in pure cultures, being identified as P. palmivora of the mating type A1. These findings confirm the heterothalic condition of the isolates and agree with other works that the A1 mating type of P. palmivora is the most common in Brazil [31–33].

The phylogenetic analysis based upon the ITS and COX2 genomic regions positioned Phytophthora isolates from azalea together with P. palmivora and close to P. quercetorum as in Martin et al. 2014 [20], confirming the species identity. In addition, likewise reported by Maseko et al. [34], the azalea isolates of P. palmivora were closely related to P. quercetorum and P. alticola considering the sequences of the COX2 and ITS regions.

The pathogenicity tests confirmed P. palmivora as the causal agent of a floral rot in azalea. In other studies, azalea plants have shown high susceptibility to Phytophthora species [35–37]. In Hong et al. [37], several Phytophthora species were found to be pathogenic to one azalea species (Rhododendron obtusum Planch.), such as P. irrigata and P. hydrophatica, new taxa recovered from irrigation water sources, in addition to P. tropicalis, P. gonapodyides, P. citricola, P. nicotiane, and P. palmivora. However, in this study, the species R. simsii was not tested as host of P. palmivora isolates.

This study shows that the isolates of P. palmivora obtained from azalea can cause disease on several species of vegetables and ornamentals like reported previously [38, 39]. According to Drenth and Guest [40], in tropical and subtropical regions, P. palmivora can attack more than 170 different species of plants, among dicotyledons and monocotyledons causing considerable losses of production. Besides that, this pathogen is able to infect many plant organs such as roots, stems, branches, flowers, leaves, and fruits.

In Brazil, besides the main crops like cacao (Theobroma cacao L.), citrus (Citrus spp.), rubber tree (Hevea brasiliensis Müll. Arg.), pejiebay or peach palm (Bactris gasipaes Kunth), papaya (Carica papaya L.), and fruit crops like soursop (Anona muricata L.), sweetsop (Anona squamosa L.), cupuaçu [Theobroma grandiflorum (wild.ex Spreng) Schum], and fig (Ficus carica L.), some ornamental plants such as anthurium or flamingo flower (Anthurium andreanum Linden), scarlet banana or red flower banana (Musa coccinea Andrews), orchid (Cattleya sp.); vegetable crops as; cabbage (Brassica oleracea L. var. acephala), scarlet eggplant (Solanum aethiopicum L.), and basil (Ocimum basilicum L.) are known hosts of P. palmivora [33, 41, 42]. The presence of this polyphagous plant pathogen in commercial areas of ornamentals is worrying because these areas are characterized by a great diversity of species in the same environment. In addition to this, the region around the municipality of Holambra-SP, is one of the main poles of flower production in Brazil, dominating the supply of flowers in practically the whole country [43]. This aspect is important from the epidemiological point of view of plant diseases, considering that long-distance dissemination of most pathogen occurs mainly through the transit of contaminated plant material.

Thus, considering the identification of oomycete species pathogenic to azalea such as P. palmivora, this is the first report of this disease in azalea in Brazil. In addition, after intense survey to the literature, there were no reports of P. palmivora causing flower rot in R. simsii in the world [5, 9]. This study extended the pathogenic action of this oomycete species corroborating previous reports that P. palmivora presents a wide host range.

Compliance with ethical standards

Conflict of interest

The authors declare that they have no conflict of interest.

Research involving human participants and/or animals

Not applicable.

Informed consent

All authors have reviewed the manuscript and approved its submission to Brazilian Journal of Microbiology.