Abstract
The spread of extended-spectrum β-lactamase (ESBL)-producing Escherichia coli has increased in different environments. This study aimed to evaluate the patterns of antibiotic resistance and ESBL genes among E. coli isolates collected from wastewater and recipient surface water in South Africa. Fifteen samples containing nine wastewater and six river water samples were collected from a local wastewater treatment plant. The E. coli isolates were detected using standard microbiology methods. Antibiotic susceptibility testing was performed using disc diffusion agar. The occurrence of blaCTX-M, blaSHV and blaTEM ESBL genes was investigated by PCR. Exactly 140 isolates were selected from the primary enumeration plates with a log10 CFU/mL count that ranged from 4.1 to 4.2 (influent), 4.2 to 4.5 (biofilter) and 2.5 to 3.3 (effluent). The wastewater effluent showed an impact on the receiving water environment, as the treatment efficiency was 92% and the downstream log10 CFU/mL count (range, 3.6–3.8 log10 CFU/mL) was higher than the upstream count (range, 3.3–3.6 log10 CFU/mL). Antibiotic testing results showed that 40% to 100% of E. coli isolates were resistant to ampicillin, penicillin, tetracycline and cefotaxime but susceptible to imipenem, meropenem and ciprofloxacin. A total of 40 studied isolates (28.6%) had both the blaTEM and blaCTX-M genes, while no blaSHV was detected. The wastewater treatment plants contributed multidrug-resistant ESBL-producing E. coli isolates that can be potential environmental health risks. Regular monitoring policies are recommended to prevent the spread of antibiotic resistance in the region.
Keywords: ESBLs, Escherichia coli, South Africa, wastewater treatment plants, WWTP
Introduction
Water scarcity for irrigation has been one of the most important setbacks for agriculture in arid and semiarid regions of the earth. Agricultural reuse of treated wastewater has been acknowledged as an effective pathway to circumvent water scarcity. Although irrigation is recognized for its immense advantages, the benefits may be exacerbated if potentially antibiotic-resistant pathogens such as Escherichia coli are identified [1,2].
From a general perspective, antibiotic-resistant bacteria and antibiotic resistance genes, including extended-spectrum β-lactamases (ESBLs), are of special concern in wastewater as they can be conveyed into the food cycle [3,4]. Their effects on human health depend on the pathogenicity of the bacteria and their potential to resist conventional antibiotics. Escherichia coli as a commensal bacterium can be plentifully transmitted to the environment through the use of manure, animal faeces, improperly treated wastewater or sewage and sewage overflow caused by heavy rains [2]. Some of the commensal as well as pathogenic E. coli strains that are excreted into the environment may have the capacity to produce ESBL enzymes. The occurrence of ESBL-producing E. coli in surface waters has been reported in different parts of the world [5,6].
Bacteria with the potential to produce ESBL are on the rise globally, with hundreds of ESBL genes reported so far. Resistance associated with production of ESBL by Enterobacteriaceae in which E. coli has been identified led to high mortality and a huge cost of hospitalization [7,8]. There has been concomitant resistance to wide range of antibiotics among E. coli harbouring ESBL genes beyond β-lactam antibiotics. Human exposure to these bacteria may occur, for instance during recreation in contaminated surface water, or indirectly, when contaminated surface water is used for irrigation of fresh crops' produce, thus contributing to community-associated dissemination of ESBL-producing E. coli [9]. The most common classes of ESBLs include blaTEM, blaSHV and blaCTX-M. Specific variants of these, such as blaSHV-5, have ability to hydrolyze broad-spectrum cephalosporins and monobactams. These β-lactamase genes are usually harboured in mobile genetic elements like plasmids and can be transferred horizontally [7].
In order to prevent further spread of E. coli harbouring ESBLs in different environments, understanding the possible influence of wastewater treatment plant (WWTP) on the surface is essential to provide insight into the contribution of different possible environmental contamination sources and exposure routes. This necessitates regular surveillance of the wastewater being reused in agriculture because of its potential effects on the food cycle [[10], [11], [12], [13]].
We aimed to determine the presence of ESBL-producing E. coli in surface water receiving effluent discharge from a WWTP, as well as the treatment efficiency and possible contribution of the WWTP to the distribution of ESBL-producing E. coli in surface water. Furthermore, the resistance profiles and presence of blaTEM, blaSHV and blaCTX-M genes were also examined.
Materials and methods
Sample collection
This 3-month study was conducted on WWTP receiving domestic, industrial and hospital wastewater in Durban, South Africa, from May to July 2017. Influent and effluent wastewater (n = 9) and surface water samples (n = 6) from the final effluent were collected from four different sampling points including influent, biofilter, effluent, upstream and downstream at different sampling times and mixed with sodium thiosulphate (100 μL in 2 L of the bottle) immediately to decrease the level of and neutralize the activity of chlorine.
Isolation and identification of potential ESBL-producing E. coli
Microbial enumeration and isolation were carried out using E. coli CHROMagar ECC (bioMérieux, Marcy l’Étoile, France). Isolation procedures were based on standard isolation procedures for the selective isolation of E. coli using chromogenic media adapted to enable the selective growth of ESBL-producing variants. Specifically, isolation and recovery of bacteria was carried out using the membrane filtration method. Multiple volumes of samples (10 mL, 1 mL and 0.1 mL) were vacuum-filtered through 0.45 μm pore size filters. Filters were then placed onto CHROMagar ECC selective for the isolation of E. coli and incubated at 37°C for 24 hours. Blueish colonies were selected for further characterization by Gram staining and standard indole, methyl red/Vogues-Proskauer and Simmon citrate (IMViC) biochemical tests. Finally, the ESBL-production was assessed using ChromID ESBLagar (bioMérieux) [14]. The isolates identified as ESBL-producing E. coli were frozen in tryptic soy broth plus 20% glycerol at −80°C [15].
Molecular identification of E. coli isolates
Molecular identification was performed on the 140 presumptive ESBL-producing E. coli isolates by PCR using the specific primers for a conserved region situated within the E. coli alanine racemase (Alr) gene (Table 1) [13]. The primers were synthesized by Inqaba Biotechnical Industries (Pty) Ltd, South Africa. The boiling method was used for DNA extraction from isolates as previously described [16]. The PCR reaction consisted of initial denaturation at 95°C for 5 minutes, 35 cycles of 30 seconds' denaturation at 95°C, annealing at 58°C for 30 seconds per extension at 72°C for 30 seconds and a final extension for 5 minutes at 72°C. E. coli ATCC 25922 was used as a positive control. The standard reaction mixture contained 1.25 units of thermostable DNA polymerase, 1 × Ex Taq buffer, 2 mM MgCl2, 10 pmol of each oligonucleotide primer, 10 nmol of dNTP and 2 μL of template DNA suspension in a final volume of 50 μL.
Table 1.
Primer sequences and expected size of PCR-amplified genes
| Gene target | Primer sequence 5′–3′ | Amplicon size (bp) |
|---|---|---|
| Alr | F: CTGGAAGAGGCTAGCCTGGACGAG R: AAAATCGGCACCGGTGGAGCGATC |
366 |
| blaCTX-M | F: CGGGAGGCAGACTGGGTGT R: TCGGCTCGGTACGGTCGA |
381 |
| blaTEM | F: GTCGCCGCATACACTATTCTCA R: CGCTCGTCGTTTGGTATGG |
258 |
| blaSHV | F: GCCTTGACCGCTGGGAAAC R: GGCGTATCCCGCAGATAAAT |
319 |
Antibiotic susceptibility testing
Antibiotic susceptibility testing was conducted following the 2017 guidelines of the Clinical Laboratory Standard Institute (CLSI) [17]. The bacterial suspensions were made in sterile phosphate-buffered saline (pH 7.4) to match a 0.5 McFarland standard in order to achieve an inoculum density of approximately 1 × 108 CFU/mL. Sterile swabs were used to inoculate the surface of Müller-Hinton agar (Merck, Darmstadt, Germany) plates from these suspensions. Antibiotic-impregnated discs were placed onto the Müller-Hinton agar surface with the use of sterile forceps. The plates were incubated for 18 to 24 hours at 37°C. The selected antibiotic discs used for this analysis included: ampicillin (10 μg), penicillin (10 U), ciprofloxacin (5 μg), tetracycline (30 μg), trimethoprim (10 μg), cefotaxime (30 μg), ceftazidime (30 μg), sulfamethoxazole (24 μg) and carbapenems (imipenem and meropenem) (10 μg). The interpretation criteria (sensitive/resistant) for the antibiotics were determined on the basis of the zone diameters provided in CLSI 2017 [17]. An isolate was designated multiple antibiotic resistant if it was resistant to at least three antibiotics classes [[18], [19], [20], [21]]. The antibiotics used in this study were selected on the basis of their clinical and agricultural significance. Each of these antibiotics has either been found at potentially active concentrations in wastewater or has previously been associated with increased resistance in environmental E. coli.
Detection of ESBL genes among E. coli using multiplex PCR
Multiplex PCR (M-PCR) was performed by using the specific primers listed in Table 1 for screening for ESBL genes in E. coli isolates [13]. The screening of blaTEM, blaSHV and blaCTX-M was done in a total volume of 25 μL containing 12.5 μL of master mix (DreamTag MM; Thermo Fisher Scientific, Waltham, MA, USA), 20 μM of each forward and reverse primers, distilled water and 5 μL of the DNA template. The M-PCR protocol was as follows: predenaturation at 95°C for 5 minutes, followed by 30 cycles of denaturation at 95°C for 30 seconds, annealing at 56°C for 40 seconds, extension at 72°C for 50 seconds and a final extension at 72°C for 10 minutes.
Statistical analyses
A statistically significant difference (p ≤ 0.05) in E. coli concentrations between sampling points and sampling time was evaluated by two-way ANOVA. Correlation analysis was performed for inference on differences in average numbers of ESBL-producing E. coli between sampling locations and time. Analyses were performed by SPSS 22 software (IBM, Armonk, NY, USA).
Results
Density of ESBL-producing E. coli in WWTP and surface water
The PCR assay confirmed all 140 isolates to be E. coli strains. All four sampling points (influent, biofilter, effluent, upstream, downstream) had ESBL-producing E. coli, with an occurrence range of 44% (region B) to 100% (region D). The concentrations of ESBL-producing E. coli in WWTP ranged from 1.0 to 4.5 log10 CFU/mL, whereas it ranged from 3.3 to 4.0 log10 CFU/mL in surface water samples. The average concentrations of ESBL-producing E. coli in the influent water (in studied WWTPs) were in the same range or slightly higher than those in the biofilter, but were significantly reduced in the effluent samples discharged into surface waters (Table 2, Table 3). Concentrations of ESBL-producing E. coli at a distance from WWTP discharge points (upstream) were comparable to that in downstream and on average were 2- to 3-log10 units higher than that in the effluent (away from the discharged point). The best treatment efficiency was 92.5% at sampling time T3, while the least was 91.9% at sampling time T2 (Fig. 1).
Table 2.
Presumptive Escherichia coli counts and pathogen log reduction from wastewater treatment plants
| Sampling point | Concentration of E. coli (log10 CFU/mL) |
|||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Influent |
Biofilter |
Effluent |
||||||||||
| T1 | T2 | T3 | Mean | T1 | T2 | T3 | Mean | T1 | T2 | T3 | Mean | |
| 1 | 4.3 | 4.1 | 4.3 | 4.2 | — | — | — | — | 3.3 | 3.3 | 0 | 2.2 |
| 2 | 4.5 | 4.3 | 4.3 | 4.4 | 4.5 | 4.2 | 4.0 | 4.2 | 3.6 | 3.0 | 3.0 | 3.2 |
| 3 | 4.3 | 4.1 | 4.0 | 4.1 | 4.3 | 4.0 | 3.5 | 3.9 | 3.0 | 0 | 0 | 1.0 |
T1, T2 and T3 refer to sampling time points.
Table 3.
Concentration of Escherichia coli in surface water samples
| Sampling point | Concentration of E. coli (log10 CFU/mL) |
|||||||
|---|---|---|---|---|---|---|---|---|
| Upstream |
Downstream |
|||||||
| T1 | T2 | T3 | Mean | T1 | T2 | T3 | Mean | |
| 1 | 3.5 | 3.0 | 3.3 | 3.3 | 3.8 | 3.4 | 3.5 | 3.33 |
| 2 | 3.3 | 3.5 | 3.5 | 3.3 | 4.0 | 4.0 | 3.6 | 3.9 |
| 3 | 3.8 | 3.3 | 3.6 | 3.6 | 3.7 | 3.7 | 3.9 | 3.8 |
T1, T2 and T3 refer to sampling time points.
Fig. 1.
Escherichia coli removal efficiency of treatment process at three different sampling times. High log reduction was observed at various stages of treatment. Treatment efficiencies was high on three sampling occasions. Error bars indicate standard deviation.
Antibiotic resistance profiles of potential ESBL-producing E. coli
The majority of E. coli from influent samples were resistant to penicillin (70%) and 30% were intermediately resistant; biofilter isolates were resistant to penicillin (100%) and cefotaxime (100%); effluent isolates were resistant to penicillin (100%) and tetracycline (80%); surface water upstream isolates were resistant to penicillin (100%) and trimethoprim (50%); and samples from downstream surface water exhibited resistance to ciprofloxacin (60%), tetracycline (60%), trimethoprim (67%) and penicillin (80%). Resistance to penicillin, tetracycline and ampicillin was frequent, whereas resistance to cefotaxime, ceftazidime and trimethoprim were less frequently observed in other parts of WWTP except the biofilter. Resistance to the carbapenem antibiotics imipenem and meropenem was not seen in the studied isolates. Remarkably, in effluent samples, ESBL E. coli was 40% to 100% resistant to ampicillin, penicillin and tetracycline but susceptible to imipenem, meropenem and ciprofloxacin. Overall, 33.3% of isolates from biofilter, 44.4% from WWTP effluents, 55.6% from upstream surface water (under the influence of WWTP discharge points) and 44.4% from surface waters downstream (not under the direct influence of the investigated WWTPs) showed resistance to at least three antibiotic categories in addition to β-lactam antibiotics. It was thus designated as a multidrug-resistant pathogen.
Overall reduction of E. coli due to treatment was in the range 1.2 to 3.1 log10 CFU/mL (Table 4). The best treatment efficiency was 92.5% and the least 91.9% (Fig. 1). Forty isolates (28.6%) had both the blaTEM and blaCTX-M genes, while no blaSHV was detected.
Table 4.
Antibiotic susceptibility results
| Sample points | Antibiotics |
Escherichia coli |
||
|---|---|---|---|---|
| S (%) | I (%) | R (%) | ||
| Influent | Imipenem | 45 | 55 | 0 |
| Meropenem | 80 | 20 | 0 | |
| Ciprofloxacin | 100 | 0 | 0 | |
| Tetracycline | 100 | 0 | 0 | |
| Penicillin | 0 | 30 | 70 | |
| Ceftazidime | 100 | 0 | 0 | |
| Ampicillin | 100 | 0 | 0 | |
| Cefotaxime | 100 | 0 | 0 | |
| Trimethoprim | 100 | 0 | 0 | |
| Biofilter | Imipenem | 100 | 0 | 0 |
| Meropenem | 100 | 0 | 0 | |
| Ciprofloxacin | 100 | 0 | 0 | |
| Tetracycline | 90 | 10 | 0 | |
| Penicillin | 0 | 0 | 100 | |
| Ceftazidime | 100 | 0 | 0 | |
| Ampicillin | 50 | 20 | 30 | |
| Cefotaxime | 0 | 0 | 100 | |
| Trimethoprim | 100 | 0 | 0 | |
| Final effluent | Imipenem | 60 | 40 | 0 |
| Meropenem | 72 | 28 | 0 | |
| Ciprofloxacin | 72 | 28 | 0 | |
| Tetracycline | 0 | 20 | 80 | |
| Penicillin | 0 | 0 | 100 | |
| Ceftazidime | 100 | 0 | 0 | |
| Ampicillin | 60 | 0 | 40 | |
| Cefotaxime | 90 | 0 | 10 | |
| Trimethoprim | 60 | 0 | 40 | |
| Downstream | Imipenem | 90 | 10 | 0 |
| Meropenem | 70 | 30 | 0 | |
| Ciprofloxacin | 40 | 0 | 60 | |
| Tetracycline | 40 | 0 | 60 | |
| Penicillin | 0 | 20 | 80 | |
| Ceftazidime | 90 | 10 | 0 | |
| Ampicillin | 80 | 0 | 20 | |
| Cefotaxime | 100 | 0 | 0 | |
| Trimethoprim | 33 | 0 | 67 | |
| Upstream | Imipenem | 100 | 0 | 0 |
| Meropenem | 100 | 0 | 0 | |
| Ciprofloxacin | 100 | 0 | 0 | |
| Tetracycline | 90 | 10 | 0 | |
| Penicillin | 0 | 0 | 100 | |
| Ceftazidime | 80 | 0 | 20 | |
| Ampicillin | 55 | 0 | 45 | |
| Cefotaxime | 80 | 0 | 20 | |
| Trimethoprim | 50 | 0 | 50 | |
I, intermediate; R, resistant; S, susceptible.
Discussion
Usually resistance of E. coli and other Enterobacteriaceae to antibiotics, particularly third-generation cephalosporins, is an expression of the blaCTX-M and blaTEM genes, which code for ESBL [13]. These groups of organisms, which are of clinical significance, have recently been placed on the World Health Organization critical list, with a global spread from the clinical environment to the natural environment through WWTPs [13,22]. In this study, a significant decimation of E. coli cells was observed at all sampling times, suggesting that the WWTP was highly efficient. However, ESBL-producing E. coli were detected in all WWTP samples as well as upstream and downstream surface water samples situated nearby and/or under the influence of the WWTP under investigation. A significant percentage of these ESBL-producing E. coli isolates were multidrug resistant. Detection of ESBL-producing E. coli correlated strongly with the relatively high concentrations of total E. coli counts (r = 0.96 at p 0.05). Nonetheless, the proportion of ESBL-producing E. coli relative to total E. coli numbers varied among the sampling points, as well as between sampling times at the same site. This observation was in consonance with a previous study conducted by Blaak et al. [14].
The receiving surface water at the points of discharge (upstream) and WWTP effluents contained ESBL-producing E. coli. The occurrence of ESBL-producing E. coli in these sampling locations may be thought to directly reflect the strains load exist in the discharged effluents at the time of sampling, even though a small quantity of them may be obtained from upstream sites. The concentrations of ESBL-producing E. coli at effluent locations were on average 1- to 2-log10 units lower than those in upstream samples (p < 0.05), and were similar to concentrations downstream of the WWTP, suggesting a possible impact of the connecting water body receiving WWTP effluent. This study demonstrated the impact of WWTP in contributing to the load of ESBL-producing E. coli in surface water with possible risk of exposure to users of that water body. To this end, studies have identified recreational freshwater swimming in surface water as a significant risk factor for acquiring urinary tract infections caused by ESBL-producing E. coli [5,23]. The results of the present study provide substantial evidence to this epidemiologic and public health concern, as ingesting contaminated surface water may lead to intestinal colonization by extraintestinal ESBL E. coli and subsequent urinary tract infection [24]. Also, the frequent existence of ESBL-producing E. coli upstream of the WWTPs and in connecting water bodies was not influenced by the studied WWTPs, suggesting the presence of other sources of ESBL-producing E. coli. The current study focused on the possible impact of discharged effluents of WWTP as a possible source of ESBL-producing E. coli in nearby surface water, but it did not investigate the contribution of sewage overflows or more remote WWTPs. Because overflows contain untreated sewage, they serve as an important source of ESBL-producing E. coli in surface water during heavy rainfall. Although the locations of overflow exhausts in the area under investigation were not mapped in this study, both overflows and more remote WWTPs may have also contributed to the faecal contamination in the investigated surface water. Moreover, animal manure may again contribute, because ESBL-producing E. coli are ample in food animals, particularly in broilers, veal calves and pigs [14]. Further to this, faeces of wild animals such as birds may contribute ESBL-producing E. coli to surface water [25]. The investigated river may be located within a suburban area, suggesting that ESBL-producing E. coli in the examined surface waters may be a mixture of human and animal origin. ESBL-producing E. coli recovered from recreational waters carried similar ESBL genes, partially in the same phylogenetic background, as ESBL-producing E. coli in effluents and/or upstream-located surface waters.
It is worth highlighting that the results this study obtained by antibiotic susceptibility profiling showed resistance to cefotaxime, a third-generation cephalosporin, in three out of the five sampling points. This is consistent with the findings of other studies that show an increasing emergence of resistance to third- and even fourth-generation cephalosporins [26,27]. Paterson and Bonomo [28] linked this resistance to hydrolysis by blaCTX-M gene–coded β-lactamase enzyme. ESBL-producing E. coli recovered from surface waters have been revealed to carry similar ESBL genes or genes partially on the same phylogenetic background [5,14,24]. The epidemiology of ESBL genes, especially blaCTX-M based, shows distinct variability around variation locations around the world [29] and are common among bacterial isolates from hospitals [[30], [31], [32]]. The current study showed some consistency with this observation, as all isolates showing resistance expressed at least one type of blaCTX-M and blaTEM genes. Several research reports from Nigeria also indicated the detection of blaCTX-M [[30], [31], [32]], though in a clinical setting. Currently, blaCTX-M-15 is the most dominant resistance gene in humans in the United States, which is accompanied by a broadly circulated strain of E. coli O:25b [33]. In tandem with our study, blaCTX-M in E. coli from wastewater samples was reported by Čornejová et al. [34]. Unlike our study, where only blaCTX-M and blaTEM were detected, a study in Bangladesh by Yesmin et al. [35] reported blaTEM (50.5%), blaCTX-M (46.7%) and blaSHV (18.7%). The emergence of such resistant species in the environment limits the optimal treatment options for ESBL infections, thereby reducing the recovery rate of ESBL patients.
This study had several limitations. Firstly, we were unable to sequence the ESBL genes. Secondly, the source of ESBL-producing E. coli into the WWTPs and surface water was not traced.
Conclusions
This study revealed that WWTP and surface water are repositories of multidrug-resistant E. coli isolates harbouring ESBL genes. This finding highlights the serious health risk to humans upon exposure. In addition, the results showed the need for effective control of the release of bacterial contaminants into local surface waters and may form the basis of future research in adjoining surface waters.
Conflict of interest
None declared.
Contributor Information
A.A. Adegoke, Email: aayodegoke@gmail.com.
M. Saki, Email: mortezasaki1981@gmail.com.
References
- 1.Hong P.Y., Julian T.R., Pype M.L., Jiang S.C., Nelson K.L., Graham D. Reusing treated wastewater: consideration of the safety aspects associated with antibiotic-resistant bacteria and antibiotic resistance genes. Water. 2018;10:244. [Google Scholar]
- 2.Johannessen G.S., Wennberg A.C., Nesheim I., Tryland I. Diverse land use and the impact on (irrigation) water quality and need for measures—a case study of a Norwegian river. Int J Environ Res Public Health. 2015;12:6979–7001. doi: 10.3390/ijerph120606979. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 3.Kraemer S.A., Ramachandran A., Perron G.G. Antibiotic pollution in the environment: from microbial ecology to public policy. Microorganisms. 2019;7:180. doi: 10.3390/microorganisms7060180. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Amarasiri M., Sano D., Suzuki S. Understanding human health risks caused by antibiotic resistant bacteria (ARB) and antibiotic resistance genes (ARG) in water environments: current knowledge and questions to be answered. Crit Rev Environ Sci Technol. 2020;50:2016–2059. [Google Scholar]
- 5.Franz E., Veenman C., van Hoek A.H., de Roda Husman A., Blaak H. Pathogenic Escherichia coli producing extended-spectrum β-lactamases isolated from surface water and wastewater. Sci Rep. 2015;5:14372. doi: 10.1038/srep14372. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.Poirel L., Madec J.Y., Lupo A., Schink A.-K., Kieffer N., Nordmann P. Antimicrobial resistance in Escherichia coli. Microbiol Spectr. 2018;6 doi: 10.1128/microbiolspec.arba-0026-2017. ARBA-0026-2017. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Pandit R., Awal B., Shrestha S.S., Joshi G., Rijal B.P., Parajuli N.P. Extended-spectrum β-lactamase (ESBL) genotypes among multidrug-resistant uropathogenic Escherichia coli clinical isolates from a teaching hospital of Nepal. Interdiscip Perspect Infect Dis. 2020;2020:6525826. doi: 10.1155/2020/6525826. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Tekiner İ.H., Özpınar H. Occurrence and characteristics of extended spectrum beta-lactamases–producing Enterobacteriaceae from foods of animal origin. Braz J Microbiol. 2016;47:444–451. doi: 10.1016/j.bjm.2015.11.034. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.Gekenidis M.T., Qi W., Hummerjohann J., Zbinden R., Walsh F., Drissner D. Antibiotic-resistant indicator bacteria in irrigation water: high prevalence of extended-spectrum beta-lactamase (ESBL)-producing Escherichia coli. PLoS One. 2018;13 doi: 10.1371/journal.pone.0207857. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 10.Blaak H., Lynch G., Italiaander R., Hamidjaja R.A., Schets F.M., de Roda Husman A.M. Multidrug-resistant and extended spectrum beta-lactamase–producing Escherichia coli in Dutch surface water and wastewater. PLoS One. 2015;10 doi: 10.1371/journal.pone.0127752. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Adegoke A.A., Faleye A.C., Singh G., Stenström T.A. Antibiotic resistant superbugs: assessment of the interrelationship of occurrence in clinical settings and environmental niches. Molecules. 2017;22:29. doi: 10.3390/molecules22010029. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 12.Adegoke A.A., Faleye A.C., Stenstrom T.A. Residual antibiotics, antibiotic resistant superbugs and antibiotic resistance genes in surface water catchments: public health impact. Phys Chem Earth. 2018;105:177–183. [Google Scholar]
- 13.Adegoke A.A., Madu C.E., Aiyegoro O.A., Stenström T.A., Okoh A.I. Antibiogram and beta-lactamase genes among cefotaxime resistant E. coli from wastewater treatment plant. Antimicrob Resist Infect Control. 2020;9:1–2. doi: 10.1186/s13756-020-0702-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 14.Blaak H., de Kruijf P., Hamidjaja R.A., van Hoek A.H., de Roda Husman A.M., Schets F.M. Prevalence and characteristics of ESBL-producing in Dutch recreational waters influenced by wastewater treatment plants. Vet Microbiol. 2014;171:448–459. doi: 10.1016/j.vetmic.2014.03.007. [DOI] [PubMed] [Google Scholar]
- 15.Yazdansetad S., Alkhudhairy M.K., Najafpour R., Farajtabrizi E., Al-Mosawi R.M., Saki M. Preliminary survey of extended-spectrum β-lactamases (ESBLs) in nosocomial uropathogen Klebsiella pneumoniae in north-central Iran. Heliyon. 2019;5 doi: 10.1016/j.heliyon.2019.e02349. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Khoshnood S., Shahi F., Jomehzadeh N., Montazeri E.A., Saki M., Mortazavi S.M. Distribution of genes encoding resistance to macrolides, lincosamides, and streptogramins among methicillin-resistant Staphylococcus aureus strains isolated from burn patients. Acta Microbiol Immunol Hung. 2019;66:387–398. doi: 10.1556/030.66.2019.015. [DOI] [PubMed] [Google Scholar]
- 17.Clinical Laboratory Standards Institute (CLSI) CLSI; Wayne, PA: 2017. Performance standards for antimicrobial susceptibility testing. Twenty-seventh informational supplement. Document M100-S27. [Google Scholar]
- 18.Abbasi Montazeri E., Seyed-Mohammadi S., Asarehzadegan Dezfuli A., Khosravi A.D., Dastoorpoor M., Roointan M. Investigation of SCCmec types I–IV in clinical isolates of methicillin-resistant coagulase-negative staphylococci in Ahvaz, southwest Iran. Biosci Rep. 2020;40 doi: 10.1042/BSR20200847. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Montazeri E.A., Khosravi A.D., Saki M., Sirous M., Keikhaei B., Seyed-Mohammadi S. Prevalence of extended-spectrum beta-lactamase–producing Enterobacteriaceae causing bloodstream infections in cancer patients from southwest of Iran. Infect Drug Resist. 2020;13:1319–1326. doi: 10.2147/IDR.S254357. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 20.Amin Mansour, Sirous M., Javaherizadeh H., Motamedifar M., Saki M., Veisi H. Antibiotic resistance pattern and molecular characterization of extended-spectrum β-lactamase producing enteroaggregative Escherichia coli isolates in children from southwest Iran. Infect Drug Resist. 2018;11:1097–1104. doi: 10.2147/IDR.S167271. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 21.Adekanmbi A.O., Adejoba A.T., Banjo O.A., Saki M. Detection of sul1 and sul2 genes in sulfonamide-resistant bacteria (SRB) from sewage, aquaculture sources, animal wastes and hospital wastewater in south-west Nigeria. Gene Rep. 2020;20:100742. [Google Scholar]
- 22.World Health Organization (WHO) 2017. WHO priority pathogens list for R&D of new antibiotics.https://www.who.int/en/news-room/detail/27-02-2017-who-publishes-list-of-bacteria-forwhich-new-antibiotics-are-urgently-needed Available at: [Google Scholar]
- 23.Søraas A., Sundsfjord A., Sandven I., Brunborg C., Jenum P.A. Risk factors for community-acquired urinary tract infections caused by ESBL-producing Enterobacteriaceae—a case–control study in a low prevalence country. PLoS One. 2013;8 doi: 10.1371/journal.pone.0069581. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 24.Tanner W.D., VanDerslice J.A., Goel R.K., Leecaster M.K., Fisher M.A., Olstadt J. Multi-state study of Enterobacteriaceae harboring extended-spectrum beta-lactamase and carbapenemase genes in US drinking water. Sci Rep. 2019;9:1–8. doi: 10.1038/s41598-019-40420-0. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 25.Guenther S., Ewers C., Wieler L.H. Extended-spectrum beta-lactamases producing E. coli in wildlife, yet another form of environmental pollution? Front Microbiol. 2011;2:246. doi: 10.3389/fmicb.2011.00246. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Grover S.S., Sharma M., Chattopadhya D., Kapoor H., Pasha S.T., Singh G. Phenotypic and genotypic detection of ESBL mediated cephalosporin resistance in Klebsiella pneumoniae: emergence of high resistance against cefepime, the fourth generation cephalosporin. J Infect. 2006;53:279–288. doi: 10.1016/j.jinf.2005.12.001. [DOI] [PubMed] [Google Scholar]
- 27.Tissera S., Lee S.M. Isolation of extended spectrum β-lactamase (ESBL) producing bacteria from urban surface waters in Malaysia. Malays J Med Sci. 2013;20:14–22. [PMC free article] [PubMed] [Google Scholar]
- 28.Paterson D.L., Bonomo R.A. Extended-spectrum β-lactamases: a clinical update. Clin Microbiol Rev. 2005;18:657–686. doi: 10.1128/CMR.18.4.657-686.2005. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 29.Hawkey P.M., Jones A.M. The changing epidemiology of resistance. J Antimicrob Chemother. 2009;64(Suppl. 1):i3–i10. doi: 10.1093/jac/dkp256. [DOI] [PubMed] [Google Scholar]
- 30.Raji M., Ojemeh O., Rotimi O. Sequence analysis of genes mediating extended-spectrum beta-lactamase production in isolates of enterobacteriaceae in Lagos Teaching Hospital. Biomed Cent Infect Dis. 2015;15:259. doi: 10.1186/s12879-015-1005-x. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Ogefere H., Aigbiremwen P., Omoregie R. Extended-spectrum beta-lactamase producing Gram negative isolates from urine and wound specimens in a tertiary health facility in Southern Nigeria. Trop J Pharma Res. 2015;14:1089–1092. [Google Scholar]
- 32.Rani S., Jahnavi I., Nagamani K. Phenotypic and molecular characterization of ESBLs producing Enterobacteriaceae in a tertiary care hospital. J Dent Med Sci. 2016;15:27–34. [Google Scholar]
- 33.Overdevest I., Willemsen I., Rijnsburger M., Eustace A., Xu L., Hawkey P. Extended-spectrum β-lactamase genes of Escherichia coli in chicken meat and humans, The Netherlands. Emerg Infect Dis. 2011;17:1216–1222. doi: 10.3201/eid1707.110209. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 34.Čornejová T., Venglovsky J., Gregova G., Kmetova M., Kmet V. Extended spectrum beta-lactamases in Escherichia coli from municipal wastewater. Ann Agric Environ Med. 2015;22:447–450. doi: 10.5604/12321966.1167710. [DOI] [PubMed] [Google Scholar]
- 35.Yesmin T., Hossain A., Paul S., Yusuf A., Sultana S., Gmowla G. Detection of extended-spectrum beta-lactamases producing genes among third generation cephalosporins sensitive bacteria strains from a medical college hospital in Bangladesh. J Allergy Disord Ther. 2014;1:1. [Google Scholar]