Table 1.

gRNAs used in this study and their predicted outcomes.

gRNA	Target Sequence + PAM a	Position in HXB2	Shannon Entropy b	Specificity c	Knock-out Efficiency c	MMEJ deletion c	Frameshiftc
tatA	TAGATCCTAGACTAGAGCCCTGG	5840–5862	0.14	76	39	61	77
tatB	CCTTAGGCATCTCCTATGGCAGG	5954–5976	0.06	91	53	89	74
tatC	CCAGGAAGTCAGCCTAAAACTGC	5891–5869	0.22	81	35	58	79
revA	CCCGACAGGCCCGAAGGAATAGA	8415–8393	0.24	94	38	77	83
revB	CACTTATCTGGGACGATCTGCGG	8475–8497	0.32	95	63	66	87
revC	CCACCGCTTGAGAGACTTACTCT	8540–8518	0.25	94	63	37	64

^a Double strand break is introduced 3 nt upstream from the underlined SpCas9 PAM sequence. ^b Conservation among 97 HIV-1 isolates of six subtypes (A, B, C, D, 01AE, and 02AG) procured from the 2014 sequence compendium (www.hiv.lanl.gov). ^c Predicted outcome scores range from 0 to 100, based on algorithms from references described in the text. In silico analysis was done using the CRISPOR tool (crispor.tefor.net). gRNA, guide RNA; PAM, protospacer adjacent motif; MMEJ, microhomology-mediated end-joining.