TABLE 3.

Strategies and genetic tools for the riboflavin-producing strains improvement.

Wild-type strain (mutant strains)	Strategies and tactics	Genetic tools and methods	Results and conclusions	References
A. gossypii ATCC 10895 (A. gossypii pAG203GLY1).	Activation of the purine pathway by: (1) Overexpression of the threonine aldolase GLY1 gene for the formation of glycine from threonine as an early precursor required for purine synthesis; growth on 1% yeast extract, 1% glucose supplemented with 50 mM threonine.	The A. gossypii gene gly1 (1146 bp ORF) was inserted into the expression plasmid pAG203 by the added sites SphI-ScaI under the control of the constitutive TEF promoter and terminator; Mycelium electroporation, geneticin-resistant spores selection (1.8 mg/ml geneticin).	(1) 10-fold increase in threonine aldolase specific activity; (2) Increase of glycine concentration from 2 ± 0.2 to 41 ± 4 mM; (3) Eightfold increase in riboflavin production: ≥17 ± 3 mg per mycelial dry weight (mdw) after 3 days of cultivation.	Monschau et al., 1998
A. gossypii ATCC 10895 (the overexpressing strain GPD-ADE4-; the mutant strains GPD-ade4-VQ and GPD-ade4-WVQ).	Activation of the purine pathway by: (1) Overexpression of the PRPP amidotransferase ADE4 gene for àbolishing the metabolic regulation of the committed step catalyzed by the enzyme PRPP amidotransferase. (2) Designing the mutant enzyme resistant to feedback inhibition by purine derivative monophosphates (AMP, GMP, ATP, and GTP) or the deletion of the enzyme gene.	(1) For gene disruption: AgADE4 ORF replaced by G418r cassette with flanked by PCR-based 50 bp of 5′- and 3′-flanking regions. (2) The overexpression module, including the A. gossypii gene AgADE4 (1533 bp, accession no. A94856) under the control of a strong 400-bp constitutive promoter of glyceraldehyde-3-phosphate dehydrogenase (AgGPD) placed 9 bp before the ATG of AgADE4 gene, was cloned into the added NcoI site of plasmid pGEM-T. The overexpression modules (including mutant GPD-ade4-VQ, and GPD-ade4-WVQ with K333/Q333 and D310/V310 substitutions) were transformed into AgΔade4 spores. Growth on a medium supplemented with 100 mg/L adenine and G418 as selective markers.	(1) 2.7-fold (77.2 mg/L) and 10-fold (228 mg/L) riboflavin production enhancement in the GPD-ADE4-and GPD-ade4-WVQ strains, respectively (the wild-type A. gossypii ATCC 10895 riboflavin production – 28 mg/L).	Jiménez et al., 2005
A. gossypii ATCC 10895 (the overexpressing strains GPD-PRS2,4 and GPD-PRS3; the mutant strains prs2,4-IQ and prs3-IQ).	Alterations in PRPP synthetase (PRS) activity, controlling the purine precursor PRPP, and involved in the de novo and salvage biosynthesis of GTP by: (1) Disruption and overexpression of two PRPP synthetases genes (AGR371C and AGL080C, in the AGD database http://agd.vital-it.ch/index.html). (2) Deregulation of the enzymes PRSs that inhibited by ADP with the use of PCR-based site-directed mutations Leu133/132/Ile133/132 and His196/195/Glu196/195 in accordance to the PRPP synthetase superactivity in humans.	For gene disruption: (1) A kanMX4 module with G418r marker of the plasmid pAG-110 (by SalI ends) blunt-ended and inserted between HincII and EcoRV sites in the AGR371C ORF, and digested with NcoI and KpnI for the spores transformation. (2) A Hygr resistance marker obtained with BamHI-KpnI ends blunt-ended and inserted between two EcoRV sites in the AGL080C ORF, and digested by EcoRI for the spores transformation. (3) For overexpression: the AGR371C and AGL080C ORFs inserted as an NdeI-BamHI fragment into the cassette allowing stable genomic integration into the AgLEU2 locus described by Jiménez et al. (2005). Growth on a medium supplemented with ADP and G418.	(1) Increased mRNA levels of both genes by 30-fold. (2) The riboflavin productivity of the overexpressed AGR371C (GPD-PRS2,4) and AGL080C (GPD-PRS3) strains – 42.4 mg/L and 40.4 mg/L, respectively, indicating a posttranslational regulatory mechanism of the enzymatic activity. (3) In the mutant strains – 80% greater the enzymatic activity in the presence of repressor ADP, however, the riboflavin production were the same as in the overexpressed PRSs strains.	Jiménez et al., 2008
A. gossypii ATCC 10895 (the mutant strains Δbas1 and ΔC631BAS1).	Constitutive activation of the purine and glycine pathways for the high GTP levels by: (1) Deletion C-terminal regulatory domain of BAS1 sensitive to the high concentration of GTP (630 to 664 aa according to BIRD domain of S. cerevisiae BAS1) in AgBAS1 (ID: AFR297W in http://agd.unibas.ch/), encoding the Myb family transcription factor involved in the regulation of purine and glycine biosynthesis, riboflavin overproduction, and growth.	(1) For insertional mutagenesis: A. gossypii genomic DNA digested with PstI and a minitransposon R comprising the 5′ and 3′ terminal repeats from the Himar1 transposon flanking the G418r marker and the bacterial replicon ColE1. Transform the E. coli DH10B by the self-ligated genomic DNA with the integrated minitransposon R to obtain the plasmid library that linearized by PstI digestion to transform A. gossypii. (2) For disruption (construction of Δbas1): The BamHI-SphI fragment of the AgBAS1 ORF replaced by G418r marker, and XhoI-BglII digested with a 356-bp 5′- and a 520-bp 3′-flanking regions homologous to the AgBAS1 locus to transform spores. For expression of the truncated AgBAS1 (1-305 aa DNA-binding domain); construction of ΔC631BAS1: A PCR-derived module containing the 50-bp fragment upstream from the 631 aa codon of AgBas1 followed by the ScADH1 terminator, the G418r marker, and the 50-bp fragment downstream from the AgBAS1 stop codon to transform A. gossypii spores and to integrate in the BAS1 locus.	(1) Bas1-independent basal transcription of the de novo purine genes in Δbas1 strain, but only in the presence of extracellular adenine. (2) The truncated ΔC631Bas1 form is insensitive to the high GTP levels and induces a constitutive transcriptional activation of ADE4 and SHM2 insensitively from extracellular adenine. (3) The riboflavin production of the wild-type A. gossypii – 2.58 ± 0.13 mg/g of biomass; In Δbas1 strain: 15.31 ± 0.23 mg/g of biomass; In ΔC631BAS1 strain: 12-fold increased in riboflavin production – 24.28 ± 0.37 mg/g of biomass after the 96-h cultivation.	Mateos et al., 2006
A. gossypii ATCC 10895 (mutant strains AgΔSHM1 and AgΔSHM2).	Activation of the glycine pathway by: (1) Disruption of the SHM1 and SHM2 genes (the EMBL Data Bank accession n. AJ438778 and AJ438779) encoding two isozymes of serine hydroxymethyltransferase for reducing carbon flux from glycine to serine.	Ashbya genomic library constructed in the cosmid vector SuperCos1 (Stratagene) screened for the positively probed enzyme-containing fragments (pJR clones). For SHM1 disruption, a 769-bp XhoI ± SalI part of AgSHM1 ORF was replaced with a 2.1-kb G418r cassette. The 2.7-kb BamHI ± KpnI digested plasmid pJR1550 SHM1769: G418 was used to transform A. gossypii, inducing DNA integration by homologous recombination. (1) For SHM2 disruption: a 1.3-kb SalI ± EcoRV part of the plasmid pJR2417 was deleted, and a 1.6-kb BamHI ± HindIII fragment containing the Hygr marker was inserted. A 2.1 kb linear fragment containing the SHM2D1300: Hygr marker was obtained by the SphI digestion of the plasmid pJR2427 to transform A. gossypii.	(1) AgDSHM1 produced the same amount of riboflavin (1.1 ± 0.2 mg/g biomass) as the wild-type (0.9 ± 0.1 mg/g biomass), the production of AgDSHM2 increased 10-fold (9.6 ± 1.0 mg/g biomass). (2)13C-labeling experiments proved the shift metabolic pathway from serine to glycine biosynthesis in the mutant strain AgΔSHM2.	Schlüpen et al., 2003
A. gossypii ATCC 10895 (the multiple-engineered Ashbya strain A330).	Activation of the RIB genes and the AMP branch of the purine nucleotide biosynthetic pathway by: (1) Overexpression of the RIB genes. (2) The inactivation and the underexpression of the ADE12 gene, which controls the first step of the AMP branch.	(1) For gene overexpression: the AgGPD promoter integrated upstream of the ATG initiator codon of each gene. An overexpression cassette comprising the AgGPD promoter (P) and the loxP-KanMX-loxP selectable marker (G418r), was PCR-amplified using specific primers for each gene. The loxP repeated inverted sequences enabled the selection marker to be eliminated, and subsequently reused, by expressing a Cre recombinase after each round of transformation. The quintuple RIB-engineered strain, which overexpresses the RIB1, RIB2, RIB3, RIB5, and RIB7 genes was obtained after 10 transformations either to integrate the AgGPD promoter into the target loci or to remove the KanMX selection marker. (2) For the deletion of AgADE12 (ade12Δ): a gene replacement cassette was constructed by PCR amplification of the loxP-KanMX-loxP marker flanked by ADE12-flanking recombinogenic sequences to transform A. gossypii. The homokaryon clones were isolated by sporulation of the primary transformants. (3) For ADE12 gene underexpression: the native promoter was replaced by the weaker (by 62-fold) promoter of the RIB7 gene using a loxP-KanMX-loxP.	(1) The ade12Δ strain produced 246 mg/L (2.5-fold increased compared to the wild-type strain), but showed adenine auxotrophy. (2) The mRNA levels of ADE12 were reduced 70-fold in the PRIB7-ADE12 strain, but sufficient without adenine supplementation and similar in the riboflavin yield with ade12Δ. (3) The strain A330 modified both for the underexpression of the ADE12 gene (PRIB7-ADE12) and for the overexpression of five RIB genes afforded the highest riboflavin yield. This strain produced 523 mg/L of riboflavin (5.4-fold higher than the wild-type).	Ledesma-Amaro et al., 2015
A. gossypii ATCC 10895 (ΔIMPDH and P GPD – IMPDH strains).	Activation of the metabolic flux through the guanine nucleotide pathway (the rate-limiting step) by: (1) The overexpression of the IMP dehydrogenase (AgIMPDH) that catalyzes the reaction at the branch point between the guanine and adenine nucleotide biosynthetic pathways.	(1) For AgIMPDH gene disruption (ΔIMPDH strain): replacement DNA cassette containing the kanMX4 selection module including G418r and flanked by specific homology regions was transformed into the spores. (2) For AgIMPDH gene overexpression (P GPD –IMPDH strain): the AgIMPDH ORF inserted into a DNA cassette comprising a module for G418r, a recombination module for stable integration into the STE12 locus (does not affect inosine, guanosine, riboflavin production, or growth rate), and an overexpression module based on the strong constitutive A. gossypii glycerol 3-phosphate dehydrogenase promoter (P GPD) and terminator.	(1) ΔIMPDH strain showed the 20-fold increase in the inosine production and decrease guanosine and riboflavin levels, and auxotrophy for guanine (growth using the action of the salvage pathway). (2) IMPDH disruption results in a 100-fold increase of inosine excretion to the culture media. (3) IMPDH overexpression significantly decreased inosine excretion, while the guanosine levels remained constant, and enhanced about 40% riboflavin production.	Buey et al., 2015
A. gossypii ATCC 10895 (the mutant strain W122032).	Activation of purine and riboflavin biosynthetic pathways by: the mutation of POL3 gene, encoding DNA polymerase δ responsible for the constitutive DNA reparation, might positive modulate carbon flow toward the purine and riboflavin synthetic pathways.	Genetic mutation technology – disparity mutagenesis. (1) The mutant-inducing vector YCpG418/poldexo construction: LEU2 (1.2 kb) of YCplac111 (Gietz and Sugino, 1998) was AatII and EcoRV excised, G480r cassette (2.5 kb) inserted into the BamHI site of MCS in YCpG418 plasmid. (2) The POL3 gene (AFL189W) including 3.3 kb ORF, 1 kb promoter and 0.6 kb terminator were mutated using PCR: 946 bp (A→C) and 952 bp (A→C). The resulting mutated POL3 (4.9 kb) inserted into the XbaI site of YCpG418 (the YCpG418 / poldexo- plasmid) was transformed into A. gossypii by electroporation. (3) Until the 18th generation, YR medium was used; from the 19th to 30th generation, YR containing 2% rapeseed oil and 3% yeast extract was used to avoid nutrient depletion. The test tube cultures were carried out at 28°C with 150 rpm for 24 h.	(1) Among 1353 colonies generated in the first screen, 26 mutants produced more than 3 g/L of riboflavin. (2) By the second screen and single-colony isolation, nine strains produced more than 5.2 g/L of riboflavin. The strains were resistant to oxalic acid and hydrogen peroxide as antimetabolites. (3) The final strain W122032 produced in a 3-L fermentor 13.7 g/l of riboflavin in an optimized medium. (4) Expression of the purine and RIB genes, particularly ade1, rib1, and rib5, more than twofold higher, RIB1 and RIB3 were expressed with sixfold higher levels. (5) While carbon source assimilation, energy generation, and glycolysis were downregulated at the riboflavin-producing phase.	Park et al., 2011
B. subtilis strain 3979 (the high-performance riboflavin production strain BSHP (B. subtilis < pHT01ribMopt >).	Reduction of the riboflavin levels in the cytoplasm enhancing the carbon flux through the riboflavin biosynthesis pathway by: Introducing the transport system for flavins that oxidatively damage the bacillus cells, thus limiting their intracellular synthesis.	B. subtilis strains overexpressing the codon-optimized ribMopt gene (GenBank FR719838) were generated using expression vector pHT01 (Mobitech, Göttingen, Germany) based on the bacillus pUB110 plasmid and used as E. coli – B. subtilis shuttle vector. 0.01–1.0 mM IPTG, 30 μg ml–1 chloramphenicol, and 10–100 μM roseoflavin as selective antimetabolite were added to the growth medium for 30-h cultivation.	(1) Transport protein RibM from S. davawensis mediates flavin (riboflavin/roseoflavin) translocation via an energy independent facilitated diffusion mechanism. (2) The strain BSHP produced about 350 mg/L riboflavin. (3) The overproduction of RibM allowed growth of a ΔribU:Kanr ΔribB:Ermr Bacillus subtilis strain.	Hemberger et al., 2011
The recombinant strain Bacillus subtilis RH33 [the recombinant strain B. subtilis PY with modified riboflavin operon; B. subtilis PYZ with an additional structural gene (zwf) gene in zwf locus].	The modulation of pentose phosphate (PP) pathway by: (1) Overexpression of glucose-6-phosphate dehydrogenase (G6PDH). (2) By the further improvement of riboflavin producer B. subtilis RH13 containing the integrative plasmid pRB63 and autonomous plasmids pRB49, pRB62 with bacillus riboflavin operon and producing 0.4 g/L of riboflavin.	(1) The modification of the heterologous riboflavin operon of Bacillus cereus ATCC14579 was carried out by replacing its native promoter with a strong constitutive promoter P43 to randomly insert in the chromosome (strain PY). (2) For overexpression of G6PDH, the integration plasmid having both Pxyl inducible promoter and the coding sequence of the structural gene zwf from B. subtilis 168 (http://www.ncbi.nlm.nih.gov/), cloned into the BamHI-SmaI site of pUC18 together with spectinomycin resistance cassette from pSG1192 (BGSC, Bacillus Genetic Stock Center). The plasmid were integrated into the zwf locus of B. subtilis chromosome by crossover homologous recombination (the strain PYZ).	(1) The PP pathway fluxes are increased in response to overexpression of G6PDH that associated with an increased intracellular pool of Ribu5P, a precursor for riboflavin biosynthesis. (2) Overexpression of G6PDH resulted in the glucose consumption rate increasing slightly, while the specific growth rate was unchanged. (3) An improvement by 25% ±2 of the riboflavin production in the strain PYZ and 0.04 g per gram in the strain PY.	Duan et al., 2010
B. subtilis 168 (the mutant strain B. subtilis PK).	The carbon flux redistribution with higher flux to PP pathway: by disruption of the low coupling bd oxidase.	Expression of cytochrome bd requires cydA and cydB, which code for the two subunits of the enzyme as well as two additional genes, cydC and cydD (Winstedt et al., 1998). To construct a cydABC deletion–insertion mutation, the primers cydA+(CCCGGGTCGGTGTTGTAAC) and cydC−(CCCGGGGGATCCTCCCGCTGAGGCAG) were designed using the sequence of the B. subtilis cyd gene obtained from GenBank and used to amplify a 3.55-kb fragment from the genomic DNA of B. subtilis 168. The fragment was digested with EcoRI and BamHI and cloned into HindIII-site-disrupted pUC18. After isolation and characterization of pUC-cyd plasmid, a chloramphenicol resistance gene (Cmr) was inserted in the middle of the cloned cyd DNA. The 1.2-kb chloramphenicol resistance cassette from plasmid pC194 was amplified using primers Cmr+(CCCGGGAAGCTTCGCTACGCTCAAATCCCTTTA) and Cmr−(CCCGGGAAGCCGACCATTC). After purification and digestion with HindIII, it was cloned into HindIII-digested pUC-cyd and gave plasmid pUCL37. ScaI-linearized pUCL37 was transformed into B. subtilis PK; transformants were selected on plates containing 5 μg of chloramphenicol/ml and then correct insertions were verified by PCR analysis.	About 30% higher precursor was availability for riboflavin biosynthes.	Li et al., 2006