Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Anti-Oct4 (Goat polyclonal) |
Abcam | Cat. No. ab27985 RRID:AB_776898 |
IF (1:200) |
| Antibody | Anti-Nanog (Goat polyclonal) |
R and D Systems | Cat. No. AF1997 RRID:AB_355097 |
IF (1:200) |
| Antibody | Anti-TRA-1–60 (Mouse monoclonal) |
Abcam | Cat. No. ab16288 RRID:AB_778563 |
IF (1:266) |
| Antibody | Anti-TRA-2–49 (Mouse monoclonal) |
Developmental Studies Hybridoma Bank | Cat No. TRA-2-49/6E RRID:AB_528073 |
IF (1:200) |
| Antibody | Anti-Pax6 (Rabbit polyclonal) |
Biolegend | Cat. No. 901301 RRID:AB_2565003 |
IF (1:200) |
| Antibody | Mouse anti-NCad (Mouse monoclonal) |
BD Biosciences | Cat. No. 610920 RRID:AB_2077527 |
IF (1:173) |
| Antibody | Anti-ZO-1 (Mouse monoclonal) |
Invitrogen | Cat. No. 33–9100 RRID:AB_2533147 |
IF (1:100) |
| Antibody | Goat anti-aPKCζ (Goat polyclonal) |
Santa Cruz | Cat. No. sc-216 RRID:AB_2300359 |
IF (1:200) |
| Antibody | Anti-Pericentrin (Mouse monoclonal) |
Abcam | Cat. No. ab28144 RRID:AB_2160664 |
IF (1:200) |
| Antibody | Anti-pHH3 (Goat polyclonal) |
Santa Cruz | Cat. No. sc-12927 RRID:AB_2233069 |
IF (1:200) |
| Antibody | Anti-Emx1 (Rabbit polyclonal) |
Thermo Scientific | Cat. No. PA5-35373 RRID:AB_2552683 |
IF (1:100) |
| Antibody | Anti-Dlx1 (Mouse monoclonal) |
Abcam | Cat. No. ab54668 RRID:AB_941307 |
IF (1:250) |
| Antibody | Anti-Tuj1 (Mouse monoclonal) |
Abcam | Cat. No. ab78078 RRID:AB_2256751 |
IF (1:200) |
| Antibody | Anti-NeuN (Rabbit monoclonal) |
Abcam | Cat. No. ab177487 RRID:AB_2532109 |
IF (1:300) |
| Antibody | Anti-rabbit conjugated with Alexa-488 (Goat polyclonal) |
Invitrogen | Cat. No. A-11034 RRID:AB_2576217 |
IF (1:500) |
| Antibody | Anti-mouse conjugated with Alexa-488 (Goat polyclonal) |
Invitrogen | Cat. No. A-11001 RRID:AB_2534069 |
IF (1:500) |
| Antibody | Anti-rabbit conjugated with Alexa-488 (Donkey polyclonal) |
Jackson | Code No. 711-545-152 RRID:AB_2313584 |
IF (1:500) |
| Antibody | Anti-goat conjugated with Alexa-488 (Donkey polyclonal) |
Jackson | Code No. 705-545-003 RRID:AB_2340428 |
IF (1:500) |
| Antibody | Anti-mouse conjugated with Alexa-488 (Donkey polyclonal) |
Jackson | Code No. 715-545-150 RRID:AB_2340820 |
IF (1:500) |
| Antibody | Anti-rabbit conjugated with Cy3 (Donkey polyclonal) |
Jackson | Code No. 711-165-152 RRID:AB_2307443 |
IF (1:500) |
| Antibody | Anti-goat conjugated with Cy3 (Donkey polyclonal) |
Jackson | Code No. 705-165-147 RRID:AB_2307351 |
IF (1:500) |
| Antibody | Anti-mouse conjugated with Cy3 (Donkey polyclonal) |
Jackson | Code No. 715-165-150 RRID:AB_2340813 |
IF (1:500) |
| Antibody | Anti-rabbit conjugated with Cy5 (Donkey polyclonal) |
Jackson | Code No. 711-175-152 RRID:AB_2340607 |
IF (1:500) |
| Antibody | Anti-goat conjugated with Cy5 (Donkey polyclonal) |
Jackson | Code No. 705-175-147 RRID:AB_2340415 |
IF (1:500) |
| Antibody | Anti-mouse conjugated with Cy5 (Donkey polyclonal) |
Jackson | Code No. 715-175-151 RRID:AB_2340820 |
IF (1:500) |
| Chemicals Compound, Drug | RHO/ROCK Pathway Inhibitor Y27632 | Stem Cell Technologies | Cat. No. 72302 | |
| Chemicals Compound, Drug | SB-431542 | Tocris | Cat. No. 1614 | |
| Chemicals Compound, Drug | LDN-193189 | Stemgent | Cat. No. 04007402 | |
| Chemicals Compound, Drug | ProLong Gold Antifade Mountant with DAPI | Thermo Fisher Scientific | Cat. No. P36931 | |
| Chemicals Compound, Drug | TRIzol | Thermo Fisher Scientific | Cat. No. 15596026 | |
| Peptides, Recombinant Proteins | Human Recombinant FGF2 | R and D Systems | Cat. No. 233-FB | |
| Peptides, Recombinant Proteins | hESC-qualified Matrigel Matrix | Corning | Product No. 354277 | |
| Peptides, Recombinant Proteins | Human Recombinant Insulin | Thermo Fisher Scientific | Cat. No. 12585014 | |
| Peptides, Recombinant Proteins | Poly-D-Lysine | Sigma Aldrich | Cat. No. P7280 | |
| Peptides, Recombinant Proteins | Laminin | Roche | Cat. No. 11243217001 | |
| Commercial Assay, Kit | Amaxa Human Dermal Fibroblast Nucleofector Kit | Lonza | Cat. No. VDP - 1001 | |
| Commercial Assay, Kit | Epi5 Reprogramming Kit | Thermo Fisher Scientific | Cat. No. A15960 | |
| Commercial Assay, Kit | GeneJET Genomic DNA purification KIT | Thermo Fisher Scientific | Cat. No. K0722 | |
| Commercial Assay, Kit | Platinum Taq DNA Polymerase High Fidelity Kit | Thermo Fisher Scientific | Cat. No. 11304011 | |
| Commercial Assay, Kit | GeneJET RNA purification kit | Thermo Fisher Scientific | Cat. No. K0731 | |
| Commercial Assay, Kit | High Capacity cDNA Reverse Transcription Kit | Applied Biosystems | Cat. No. 4368814 | |
| Cell Line (Homo-sapiens) | 16p11.2 Deletion and Duplication iPSC lines | SFARI | See Figure 2—figure supplement 1 | |
| Cell Line (M. musculus) | DR4 MEF Feeder Cells | Transgenic Mouse Facility at Stanford University | ||
| Recombinant DNA Reagent | pCXLE-hOCT3/4-shp53-F | Addgene | Cat. No. Plasmid27077 | |
| Recombinant DNA Reagent | pCXLE-hSK | Addgene | Cat. No. Plasmid27078 | |
| Recombinant DNA Reagent | pCXLE-hUL | Addgene | Cat. No. Plasmid27080 | |
| Sequence-based Reagent | pCXLE-hOCT4-shp53-F-fwd | This paper | PCR primers | CAGTGTCCTTTCCTCTGGCCCC |
| Sequence-based Reagent | pCXLE-hOCT4-shp53-F-rev | This paper | PCR primers | ATGAAAGCCATACGGGAAGCAATAGC |
| Sequence-based Reagent | pCXLE-hSK-fwd | This paper | PCR primers | AATGCGACCGAGCATTTTCCAGG |
| Sequence-based Reagent | pCXLE-hSK-rev | This paper | PCR primers | TGCGTCAGCAAACACAGTGCACA |
| Sequence-based Reagent | pCXLE-hUL-fwd | This paper | PCR primers | CAGAGCATCAGCCATATGGTAGCCT |
| Sequence-based Reagent | pCXLE-hUL-rev | This paper | PCR primers | ACAACGGGCCACAACTCCTCAT |
| Sequence-based Reagent | Actb-fwd | This paper | PCR primers | AGAGCTACGAGCTGCCTGAC |
| Sequence-based Reagent | Actb-rev | This paper | PCR primers | AGCACTGTGTTGGCGTAGAC |
| Sequence-based Reagent | Hand1-fwd | This paper | PCR primers | GTGCGTCCTTTAATCCTCTTC |
| Sequence-based Reagent | Hand1-rev | This paper | PCR primers | GTGAGAGCAAGCGGAAAAG |
| Sequence-based Reagent | Sox17-fwd | This paper | PCR primers | CGCACGGAATTTGAACAGTA |
| Sequence-based Reagent | Sox17-rev | This paper | PCR primers | GGATCAGGGACCTGTCACAC |
| Sequence-based Reagent | Pax6-fwd | This paper | PCR primers | TGGGCAGGTATTACGAGCTG |
| Sequence-based Reagent | Pax6-rev | This paper | PCR primers | ACTCCCGCTTATACTGGGCTA |
| Software, Algorithm | SnapGene | SnapGene | RRID:SCR_015052 | |
| Software, Algorithm | ImageJ | ImageJ | RRID:SCR_003070 | |
| Software, Algorithm | Photoshop | Adobe | RRID:SCR_014199 | |
| Software, Algorithm | Prism v7.04 | GraphPad | RRID:SCR_002798 | |
| Software, Algorithm | FastQC v0.11.6 | Babraham Bioinformatics | RRID:SCR_014583 | |
| Software, Algorithm | kallisto v0.43.1 | Pachter Lab | RRID:SCR_016582 | |
| Software, Algorithm | R | R Project for Statistical Computing | RRID:SCR_001905 | |
| Software, Algorithm | RStudio | RStudio | RRID:SCR_000432 | |
| Software, Algorithm | Tximport v1.8.0 | tximport | None yet available | |
| Software, Algorithm | DESeq2 v1.20.0 | DESeq2 | RRID:SCR_015687 | |
| Software, Algorithm | ggplot2 v3.0.0 | ggplot2 | RRID:SCR_014601 | |
| Software, Algorithm | pheatmap v1.0.10 | pheatmap | RRID:SCR_016418 | |
| Software, Algorithm | GSEA | Broad Institute | RRID:SCR_003199 | |
| Software, Algorithm | EnrichmentMap | Bader Lab | RRID:SCR_016052 | |
| Software, Algorithm | Cytoscape | Institute for Systems Biology; Washington; USA; University of California at San Diego; California; USA | RRID:SCR_003032 | |
| Software, Algorithm | UCSC Genome Browser | University of California at Santa Cruz; California; USA | RRID:SCR_005780 | |
| Software, Algorithm | STAR v2.5.3a | STAR | RRID:SCR_015899 | |
| Software, Algorithm | LIMMA v3.36.5 | LIMMA | RRID:SCR_010943 | |
| Software, Algorithm | WGCNA | University of California at Los Angeles; California; USA | RRID:SCR_003302 | |
| Software, Algorithm | 16 p resource Code | Kristin L. Muench | RRID:SCR_016845 | |
| Other | Genome-Wide Human SNP Array, 6.0 platform | Affymetrix | Performed by CapitalBio Corp., Beijing, China | |
| Other | Ultra-low attachment and ultra-low cluster 96-well plates | Corning | Cat. No. CLS3474 | |
| Other | Lumox 50 mm plates | Sarstedt | Cat. No. 833925 | |
| Other | NextSeq 500 | Illumina | Performed byStanford Functional Genomics Facility, Stanford, California, U.S.A. |