Table 2.

Primer and TaqMan probe combinations for the detection of complement components via qRT-PCR.

Gene ID	Primer Sequences: Forward	Primer Sequences: Reverse	TaqMan® Probe from Roche	Accession Number
idh3b	5′ gctgcggcatctcaatct 3′	5′ ccatgtctcgagtccgtacc 3′	# 67	NM_130884.4
c1s	5′ ggtggatacttctgctcctgtc 3′	5′ agggcagtgaacacatctcc 3′	# 69	NM_144938.2
c3	5′ accttacctcggcaagtttct 3′	5′ ttgtagagctgctggtcagg 3′	# 76	NM_009778.3
cfb	5′ ctcgaacctgcagatccac 3′	5′ tcaaagtcctgcggtcgt 3′	# 112	NM_008198.2
cfp	5′ tcttgagtggcagctacagg 3′	5′ cagaccagccacccatct 3′	# 56	NM_008823.4
cfh	5′ aaaaaccaaagtgccgagac 3′	5′ ggaggtgatgtctccattgtc 3′	# 25	NM_009888.3
cfi	5′ tttctcttggctctccacttg 3′	5′ tgcagtaagcatttctgatcg 3′	# 63	NM_007686.3