Table 1.
Transcripts selected for RNA-seq data validation by quantitative real-time polymerase chain reaction (qRT-PCR). Regarding the data discussed in the text, 3 down-expressed and 3 up-regulated coding genes were chosen for data validation. For each gene, the HUGO (Human Genome Organization) Gene Nomenclature Committee (HGNC) name, the Ensembl-specific transcript ID, the log2 fold change detected by RNAseq at both 3 and 6 h after N-retinylidene-N-retinylethanolamine (A2E) treatment, the primer pair and the specific length of the amplicon are reported. FC: fold change; bp: base-pairs.
| HGNC Gene Name (ID) | Ensembl Transcript ID |
3 h_vs._0 h RNAseq log2 FC |
6 h_vs._0 h RNAseq log2 FC |
Primer Pair | Fragment Length (bp) |
|---|---|---|---|---|---|
| OCLN (8104) | ENST00000355237.2 | −0.873423348 | −1.391662424 | ACTTCGCCTGTGGATGACTT GACCTTCCTGCTCTTCCCTT |
101 |
| RICTOR (28611) | ENST00000357387.8 | −0.940830609 | −0.705087984 | GCTCTCTGAAGAACCTCCGA CCTGCAATCTGGCCACATTT |
126 |
| TJP1 (11827) | ENST00000356107.10 | −0.694212076 | −1.059176648 | TCTTCGCAGCTCCAAGAGAA AGGCCTCAGAAATCCAGCTT | 121 |
| FZD4 (4042) | ENST00000531380.2 | 0.37699785 | 0.532274651 | GGTTTGGTGGCCTTGTTCAA ATCACACACGTTGCAGGAAC |
131 |
| KIFC3 (6326) | ENST00000445690.7 | 0.995878391 | 1.422298598 | GACCCTCACCAACGACTACA TTGCTGTTGACCTCCTCGAT |
123 |
| VEGFA (12628) | ENST00000372055.8 | 0.137384927 | 1.016674127 | CTGTCTTGGGTGCATTGGAG TGATGATTCTGCCCTCCTCC |
101 |