Skip to main content
. 2020 Oct 7;2020:10.17912/micropub.biology.000317. doi: 10.17912/micropub.biology.000317

Table 1: Primers used in this study

Primer Name Sequence Purpose Origination
HKP590 tttgttgaaaagtctcaataaagcttcgacgagtcagtaataaacg Fragment amplification, universal forward – pG20_hyg constructs This work
HKP591 caaacacatacagcgacttagtttacccgccaatatatcc Fragment amplification, universal reverse – pG20_hyg constructs This work
HKP592 tattggcgggtaaactaagtcgctgtatgtgtttgtttgag Vector amplification, forward – pG20_hyg constructs This work
HKP593 cgtttattactgactcgtcgaagctttattgagacttttcaacaaagg Vector amplification, reverse – pG20_hyg constructs This work
HKP867 gagcagaagctgatctcggaggaagacttgtaagagctcatatgaagatgaagatg Creation of Myc sequence, forward – pG20_hyg construct This work
HKP868 ttacaagtcttcctccgagatcagcttctgctccccgggagcggtaccctcg Creation of Myc sequence, reverse – pG20_hyg construct This work
HKP869 gactacaaggatgacgatgacaagtaagagctcatatgaagatgaagatg Creation of FLAG sequence, forward – pG20_hyg construct This work
HKP870 ttacttgtcatcgtcatccttgtagtccccgggagcggtaccctcg Creation of FLAG sequence, reverse – pG20_hyg construct This work
HKP871 catcaccatcaccatcactaagagctcatatgaagatgaagatg Creation of 6xHis sequence, forward – pG20_hyg construct This work
HKP872 ttagtgatggtgatggtgatgcccgggagcggtaccctcg Creation of 6xHis sequence, reverse – pG20_hyg construct This work
HKP881 ggcatctacttcagatttcggtgacggg Glufosinate fragment amplification, forward This work
HKP882 gatcccccctatgagcccagaacgac Glufosinate fragment amplification, reverse This work
HKP883 ctgggctcataggggggatcagcttg Vector amplification, universal forward – pG20_blp constructs This work
HKP884 cgaaatctgaagtagatgccgaccga Vector amplification, universal reverse – pG20_blp constructs This work