REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
Purified DR2a allele-specific monoclonal antibody	Purchased under an agreement from One Lambda (Thermo Fisher Scientific)	N/A
Purified DR2b allele-specific monoclonal antibody	Purchased under an agreement from One Lambda (Thermo Fisher Scientific)	N/A
Alexa Fluor 488-conjugated DR2a-specific antibody	Purchased under an agreement from One Lambda (Thermo Fisher Scientific)	N/A
Alexa Fluor 647-conjugated DR2b-specific antibody	Purchased under an agreement from One Lambda (Thermo Fisher Scientific)	N/A
Goat anti-Mouse IgG1 Cross-Adsorbed Secondary Antibody, Alexa Fluor 488	Invitrogen	Cat# A-21121; RRID:AB_2535764
Goat anti-Mouse IgG2b Cross-Adsorbed Secondary Antibody, Alexa Fluor 647	Invitrogen	Cat# A-21242; RRID:AB_2535811
FITC anti-human CD69 antibody (clone FN50)	BD PharMingen	Cat# 555530; RRID:AB_395915
APC anti-human CD25 antibody (clone BC96)	Biolegend	Cat# 302610; RRID:AB_314280
PE/Cy7 anti-human TCR α/β antibody (clone IP26)	Biolegend	Cat# 306720; RRID:AB_10639947
Pacific Blue anti-human CD4 antibody (clone OKT4)	Biolegend	Cat# 317429; RRID:AB_1595438
PerCP/Cy5.5 anti-human CD3 antibody (clone OKT3)	Biolegend	Cat# 317336; RRID:AB_2561628
PE/Cy7 anti-human CD14 Antibody (clone 63D3)	Biolegend	Cat# 367112; RRID:AB_2566714
Alexa Fluor® 700 anti-human CD19 Antibody (clone HIB19)	Biolegend	Cat# 302226; RRID:AB_493751
APC anti-human CD45RA (clone HI100)	Biolegend	Cat# 304112; RRID:AB_314416
Alexa Fluor® 700 anti-human CD45 Antibody (clone 2D1)	Biolegend	Cat# 368514; RRID:AB_2566374
PerCP/Cyanine5.5 anti-human CD326 (EpCAM) Antibody (clone 9C4)	Biolegend	Cat# 324214; RRID:AB_2098808
APC/Fire 750 anti-human HLA-DR Antibody (clone L243)	Biolegend	Cat# 307658; RRID:AB_2572101
Pacific Blue anti-human CD8 Antibody (Clone SK1)	Biolegend	Cat# 344718; RRID:AB_10551438
Alexa Fluor® 700 anti-human CD183 (CXCR3) Antibody (Clone G025H7)	Biolegend	Cat# 353742; RRID:AB_2616920
Brilliant Violet 785 anti-human CD196 (CCR6) Antibody (Clone G034E3)	Biolegend	Cat# 353422; RRID:AB_2563660
PE anti-human HLA-DR Antibody (Clone L243)	Biolegend	Cat# 307606; RRID:AB_314684
Purified anti-human HLA-DR Antibody (Clone L243)	Provided by HG. Rammensee, University of Tubingen, Germany	N/A
TCR Vβ1-PE, BL37.2, 1 mL, ASR	Beckman Coulter	Cat# IM2355; RRID:AB_131329
TCR Vβ2-PE, MPB,2D5, 1 mL, ASR	Beckman Coulter	Cat# IM2213; RRID:AB_131311
TCR Vβ3-FITC, CH92, 1 mL, ASR	Beckman Coulter	Cat# IM2372; RRID:AB_131046
TCR Vβ5.1-FITC, IMMU 157, 1 mL, ASR	Beckman Coulter	Cat# IM1552; RRID:AB_131023
TCR Vβ5.2-FITC, 36213, 1 mL, ASR	Beckman Coulter	Cat# IM1482; RRID:AB_130872
TCR Vβ7.1-PE, ZOE, 1 mL, ASR	Beckman Coulter	Cat# IM2287; RRID:AB_131323
TCR Vβ8-FITC, 56C5.2, 1 mL, ASR	Beckman Coulter	Cat# IM1233; RRID:AB_130922
TCR Vβ9-PE, FIN9, 1 mL, ASR	Beckman Coulter	Cat# IM2003; RRID:AB_131193
TCR Vβ11-FITC, C21, 1 mL, ASR	Beckman Coulter	Cat# IM1586; RRID:AB_131027
TCR Vβ12-PE, VER2.32.1, 1 mL, ASR	Beckman Coulter	Cat# IM2291; RRID:AB_131198
TCR Vβ13.1-PE, IMMU 222, 1 mL, ASR	Beckman Coulter	Cat# IM2292; RRID:AB_131326
TCR Vβ13.6-FITC, JU74.3, 1 mL, ASR	Beckman Coulter	Cat# IM1330; RRID:AB_131012
TCR Vβ14-PE, CAS1.1.3, 1 mL, ASR	Beckman Coulter	Cat# IM2047; RRID:AB_131304
TCR Vβ16-FITC, TAMAYA1.2, 1 mL, ASR	Beckman Coulter	Cat# IM1560; RRID:AB_130875
TCR Vβ17-FITC, E17.5F3.15.13, 1 mL, ASR	Beckman Coulter	Cat# IM1234; RRID:AB_131007
TCR Vβ18-PE, BA62.6, 1 mL, ASR	Beckman Coulter	Cat# IM2049; RRID:AB_131305
TCR Vβ20-PE, ELL1.4, 1 mL, ASR	Beckman Coulter	Cat# IM2295; RRID:AB_131328
TCR Vβ21.3-FITC, IG125, 1 mL, ASR	Beckman Coulter	Cat# IM1483; RRID:AB_131021
TCR Vβ22-FITC, IMMU 546, 1 mL, ASR	Beckman Coulter	Cat# IM1484; RRID:AB_131022
TCR Vβ23-PE, AF23, 1 mL, ASR	Beckman Coulter	Cat# IM2004; RRID:AB_131302
TCR Vβ5.3-PE, 3D11, 1 mL, ASR	Beckman Coulter	Cat# IM2002; RRID:AB_131230
Purified Mouse IgG2a, κ Isotype Ctrl Antibody	Biolegend	Cat# 401502; RRID:AB_2800437
Biological Samples
Peripheral blood	This paper	N/A
Peripheral blood	This paper	N/A
Leukaphereses from MS patients	This paper	N/A
Buffy coats from HDs	This paper	N/A
Thymic tissues	This paper	N/A
MS brain tissues	This paper	N/A
Cerebrospinal fluid (CSF)	This paper; Planas et al., 2018	N/A
Chemicals, Peptides, and Recombinant Proteins
Bovine serum albumin (BSA)	Roth	Cat# 3854.3
Carboxyfluorescein diacetate N-succinimidyl ester (CFSE)	Sigma-Aldrich	Cat# 21888
Dimethyl sulfoxide (DMSO)	Applichem	Cat# A3672
Ficoll	Eurobio	Cat# GAUFIC0065
EDTA solution pH 8.0 (0.5 M)	AppliChem	Cat# A3145,1000
L-glutamine	Thermo Fisher Scientific	Cat# 25030024
Penicillin-Streptomycin Solution, 100x	Corning	Cat# 30-002-CI
Gentamicin	Sigma-Aldrich	Cat# G1397
Human IL-2 containing supernatant (produced with T6 cell line)	Provided by F. Sallusto, IRB, Bellinzona, Switzerland	N/A
Positional scanning synthetic combinatorial peptide libraries (ps-SCL, N-acetylated and C-amide, TPI 2040)	Pinilla et al., 1994	N/A
LIVE/DEAD Fixable Aqua Dead Cell Stain Kit	Thermo Fisher Scientific	Cat# L34957
Methyl-3H-thymidine	Hartmann Analytic	Cat# M1762
Peptides	Peptides&Elephants	This paper, see also Table S5 and S7
Remel PHA Purified	Thermo Fisher Scientific	Cat# R30852801
QIAzol lysis reagent	QIAGEN	Cat# 79306
CEF II peptide pool	Peptides&Elephants	N/A
Phytohemagglutinin-L (PHA-L)	Sigma-Aldrich	Cat# L2769
Liberase TM Research Grade	Roche	Cat# 5401119001
DNase I, recombinant	Roche	Cat# 04536282001
Percoll	GE healthcare	Cat# 17-0891-01
Triton X-100	Sigma-Aldrich	Cat# T8787
Proteinase K	Roche	Cat# 03115879001
MEM Non-Essential Amino Acids Solution (100X)	GIBCO	Cat# 11140050
Sodium Pyruvate (100 mM)	GIBCO	Cat# 11360070
2-Mercaptoethanol (50 mM)	GIBCO	Cat# 31350010
Poly-L-lysine solution	Sigma-Aldrich	Cat# P8920
Immunoglobulin G from human serum	Sigma-Aldrich	Cat# 56834
CHAPS	PanReac AppliChem	Cat# A1099.0050
cOmplete Protease Inhibitor Cocktail	Roche	Cat# 11697498001
Trifluoroacetic acid (TFA)	Sigma-Aldrich	Cat# 299537
RPMI-1640 medium	Sigma-Aldrich	Cat# R0883
X-Vivo medium	Lonza	Cat# BE04-418F
Fetal calf serum (FCS)	Eurobio	Cat# CVFSVF0001
Human serum	Blood Bank Basel, Switzerland	N/A
IMDM medium	GE healthcare	Cat# SH30259.01
Polyethylene glycol solution	Sigma-Aldrich	Cat# P7181
HAT Media Supplement (50 × ) Hybri-Max	Sigma-Aldrich	Cat# H0262
Fetal Bovine Serum	Corning	Cat# 35-010-CV
RPMI 1640 Medium	Thermo Fisher Scientific	Cat# 11875101
Penicillin-Streptomycin Solution	Thermo Fisher Scientific	Cat# 15140130
Critical Commercial Assays
CD19 MicroBeads, human	Miltenyi Biotec	Cat# 130-050-301, RRID:AB_2848166
CD14 MicroBeads, human	Miltenyi Biotec	Cat# 130-050-201, RRID:AB_2665482
CD45RA MicroBeads, human	Miltenyi Biotec	Cat# 130-045-901
CD4 T Cell Isolation Kit, human	Miltenyi Biotec	Cat# 130-096-533
Pan Monocyte Isolation Kit, human	Miltenyi Biotec	Cat# 130-096-537
CD4 MicroBeads, human	Miltenyi Biotec	Cat# 130-045-101
ELISA MAX Standard Set Human IFN-γ	Biolegend	Cat# 430101
LEGENDplex Human T Helper Cytokine Panels	Biolegend	Cat# 740001, RRID:AB_2784515
T Cell Activation/Expansion Kit, human	Miltenyi Biotec	Cat# 130-091-441
Image-iT Fixation/Permeabilization Kit	Invitrogen	Cat# R37602
SlowFade Diamond Antifade Mountant with DAPI	Invitrogen	Cat# S36968
RNeasy Mini Kit (50)	QIAGEN	Cat# 74104
PCR Master Mix (2X)	Thermo Scientific	Cat# K0171
RevertAid First Strand cDNA Synthesis Kit	Thermo Scientific	Cat# K1621
Deposited Data
RNA sequencing data of B cells and monocytes	This paper	ENA: PRJEB34207
RNA sequencing data of thymic epithelial cells (TECs)	This paper	ENA: PRJEB34209
RNA sequencing data of peptide-stimulated TCC14 cells	This paper	ENA: PRJEB35576
Amino acid sequences of the eluted peptides	This paper	ProteomeXchange Consortium: PXD015249
Immunopeptidomic data from tumor tissues, unaffected surrounding tissue, and blood samples	HLA Ligand Atlas	https://hla-ligand-atlas.org/search
Experimental Models: Cell Lines
BLS-DR2a cells	Generated by B. Kwok, Benaroya Research Institute, Seattle	N/A
BLS-DR2b cells	Generated by B. Kwok, Benaroya Research Institute, Seattle	N/A
TCC3A6	Vergelli et al., 1996	N/A
TCC5F6	Vergelli et al., 1997	N/A
TCC14	Jelcic et al., 2018	N/A
Oligonucleotides
Primer: TRBC Reverse: gacagcggaagtggttgcgggggt	Microsynth	N/A
Primer: TRBV3-1 Forward: cctaaatctccagacaaagc	Microsynth	N/A
Primer: TRBV12-3/4 Forward: tctggtacagacagaccatg	Microsynth	N/A
Software and Algorithms
FlowJo	Tree Star	https://www.flowjo.com/ ; RRID: SCR_008520
GraphPad Prism 8.0	Graphpad	https://www.graphpad.com/ ; RRID: SCR_002798
ImageJ	NIH	https://imagej.nih.gov/ij/ ; RRID:SCR_003070
NetMHCII 2.3 Server	Jensen et al., 2018	http://www.cbs.dtu.dk/services/NetMHCII-2.3/
Venny2.1	Oliveros, J.C. (2007-2015) Venny. An interactive tool for comparing lists with Venn’s diagrams.	https://bioinfogp.cnb.csic.es/tools/venny/index.html ; RRID:SCR_016561
IMGT/V-QUEST	Brochet et al., 2008	http://www.imgt.org/IMGT_vquest/vquest ; RRID:SCR_010749
iceLogo	Colaert et al., 2009	https://iomics.ugent.be/icelogoserver/ ; RRID:SCR_012137
Heatmapper	Babicki et al., 2016	http://www.heatmapper.ca/ ; RRID:SCR_016974