| Antibodies |
| Anti UCH37 |
Abcam |
ab124931 |
| Anti RPN11 |
Abcam |
ab109130 |
| Anti RPN13 |
Cell Signaling Technology |
D9Z1U |
| Anti RPT2 |
Abcam |
ab3317 |
| Anti PSMB7 |
R&D Systems |
MAB7590 |
| Anti USP14 |
Abcam |
ab56210 |
| Anti beta Actin |
Abcam |
ab8227 |
| Anti Ub |
Enzo Lifesciences |
BML-PW0930 |
| Anti K48-linkage Specific |
Cell Signaling Technology |
D9D5 |
| Anti Ub, K11/K48 Bispecific |
Genentech |
N/A |
| Goat Anti Mouse IR Dye 800CW |
LI-COR Biosciences |
926-32210 |
| Goat Anti Rabbit IR Dye 680RD |
LI-COR Biosciences |
926-68071 |
| Goat Anti Rabbit IR Dye 800CW |
LI-COR Biosciences |
926-32211 |
| Goat Anti Human IR Dye 680LT |
LI-COR Biosciences |
926-68032 |
| Bacterial and Virus Strains |
| Rosetta 2(DE3)pLysS |
EMD Millipore Novagen |
71403-3 |
| BL21(DE3)pLysS |
Promega |
L1191 |
| One Shot™ TOP10 |
Fisher Scientific |
C404003 |
| One Shot™ Stbl3 |
Fisher Scientific |
C737303 |
| Chemicals, Peptides, and Recombinant Proteins |
| ProBlock Gold Mammalian Protease Inhibitor Cocktail |
Gold Biotechnology |
GB-331-5 |
| Simple Stop™ 2 Phosphatase Inhibitor Cocktail |
Gold Biotechnology |
GB-451 |
| Ammonium Chloride (15N, 99%) |
Cambridge Isotope Laboratories |
NLM-467 |
| SYPRO Ruby Stain |
Fisher Scientific |
S12000 |
| Cy5 maleimide |
Lumiprobe |
23080 |
| DBCO-Cy5 |
Sigma-Aldrich |
777374 |
| Click-iT™ AHA (L-Azidohomoalanine) |
Fisher Scientific |
C10102 |
| Trypsin |
Promega |
V5113 |
| Chymotrypsin |
Promega |
V1061 |
| Formic Acid |
Sigma-Aldrich |
399388 |
| Acetic Acid |
Fisher Scientific |
351269-4 |
| Creatine phosphate disodium salt |
Abcam |
ab146255 |
| Creatine Kinase |
Sigma-Aldrich |
10127566001 |
| Adenosine-5’-triphosphate |
Gold Biotechnology |
A-081-5 |
| Ub-AMC |
Boston Biochem |
U-550 |
| Suc-LLVY-AMC |
Boston Biochem |
S-280 |
| MG132 |
Fisher Scientific |
508339 |
| Bortezimib |
Selleck Chemicals |
S1013 |
| Polybrene |
Sigma-Aldrich |
TR-1003-G |
| Lipofectamine 3000™ |
Fisher Scientific |
L3000008 |
| Doxycycline hyclate |
Sigma-Aldrich |
D9891 |
| L-Methionine |
Sigma-Aldrich |
64319-25G-F |
| Carfilzomib (PR-171) |
Selleck Chemicals |
S2853 |
| AQUA peptides |
Cell Signaling Technology |
see Table S1
|
| Critical Commercial Assays |
| Alt-R® S.p. Cas9 Nuclease 3NLS |
Integrated DNA Technologies |
1081058 |
| PTMScan® Ubiquitin Remnant Motif |
Cell Signaling Technology |
14482 |
| pENTR™/SD/D-TOPO™ Cloning Kit |
Fisher Scientific |
K242020 |
| Gateway LR Clonase II Enzyme Mix |
Fisher Scientific |
11-791-020 |
| Deposited Data |
| Raw and analyzed data |
This study; Mendeley Data |
http://dx.doi.org/10.17632/pv8t3hbg4t.1 |
| Experimental Models: Cell Lines |
| HEK293 Expressing Rpn11-HTBH |
Applied Biological Materials |
T6007 |
| HEK293 Expressing Rpn11-HTBH UCH37 KO |
This study |
N/A |
| HEK293 Expressing Rpn11-HTBH RPN13 KO |
This study |
N/A |
| HEK293 FT |
ATCC |
CRL-3216 |
| HEK293 FT UCH37 KO |
This study |
N/A |
| HEK293 GFPu
|
ATCC |
CRL-2794 |
| HEK293 GFPu UCH37 KO |
This study |
N/A |
| Oligonucleotides |
| CRISPR KO sgDNA sequence UCH37 (1) |
Integrated DNA Technologies |
GTTACTGAACTGTACCCACC |
| CRISPR KO sgDNA sequence UCH37 (2) |
Integrated DNA Technologies |
CGCCTAAATGGACATCCTGG |
| CRISPR KO sgDNA sequence RPN13 |
Integrated DNA Technologies |
CACGAACTCTCTGCGCTAGG |
| Recombinant DNA |
| pMCSG20: NleL (aa 170-782) |
Valkevich et al., 2014 |
N/A |
| pQE30: SortaseΔN25 (SrtA) |
Crowe et al., 2016 |
gifted from O. Schneewind |
| pVP16: UCH37 |
DNASU |
HsCD00084019 |
| pET19: RPN13 |
Yao et al., 2006 |
Addgene, Plasmid #19423 |
| pGEX-6P1: hRPN2 (aa 916-953) |
Lu et al., 2015a |
gifted from K. Walters |
| pET28b: E1 |
Trang et al., 2012 |
N/A |
| pGEX-4T2: UBE2D3 |
Valkevich et al., 2014 |
N/A |
| pGEX-6P1: UBE2S-UBD |
Bremm et al., 2010 |
Addgene, Plasmid #66713 |
| pGEX-6P1: AMSH |
Trang et al., 2012 |
N/A |
| pOPINK: OTUD1 |
Mevissen et al., 2013 |
Addgene, Plasmid #61405 |
| pVP16: OTUB1 |
Pham et al., 2015 |
N/A |
| pOPINS: UBE3C |
Michel et al., 2015 |
Addgene, Plasmid #66711 |
| pDEST17: UBE2R1 |
Pham et al., 2015 |
N/A |
| pST39: UBE2N/UBE2V2 |
Pham et al., 2015 |
N/A |
| pET28b: UBC1 |
DNASU |
ScCD00009212 |
| pOPINK: RSP5 |
DNASU |
ScCD00008707 |
| pOPINS: Titin I27V15P 23-K-35 |
Bard et al., 2019 |
N/A |
| pET22b: Ub and Ub variants |
Valkevich et al., 2012 |
N/A |
| pET28b: SUMO2 |
Mikolajczyk et al., 2007 |
Addgene, Plasmid #25102 |
| pET22b: GFP |
Dantuma et al., 2000 |
Addgene, Plasmid #11938 |
| pMD2.G |
gifted from Didier Trono |
Addgene, Plasmid #12259 |
| psPAX2 |
gifted from Didier Trono |
Addgene, Plasmid #12260 |
| pINDUCER21 |
Meerbrey et al., 2011 |
Addgene, Plasmid #46948 |
| pCW57-MCS1-P2A-MCS2 (RFP) |
Barger et al., 2019 |
Addgene, Plasmid #80923 |
| Software and Algorithms |
| Typhoon FLA 9500 |
GE Healthcare |
N/A |
| Odyssey CLx Imager |
LICOR Biosciences |
N/A |
| Image Studio software |
LICOR Biosciences |
N/A |
| Prism 8 |
Graphpad Software |
N/A |
| OriginLab 7 SR4 |
OriginLab Corporation |
N/A |
| Xcalibur 3.0 |
Thermo Fisher Scientific |
N/A |
| Pinpoint 1.4 |
Thermo Fisher Scientific |
N/A |
| Proteome Discoverer 2.3 |
Thermo Fisher Scientific |
N/A |
| Mash Suite |
Guner et al., 2014 |
N/A |
| FlowJo 10.4 |
FlowJo, LLC |
N/A |
| Other |
| His60 Ni Superflow resin |
Clontech |
635660 |
| Glutathione resin |
GenScript |
L00206 |
| Amylose resin |
NEB |
E8021S |
| Streptavidin resin |
GenScript |
L00353 |
| Anti-Flag M2 Affinity Gel |
Sigma-Aldrich |
A2220 |
| Slide-A-lyzer MINI dialysis units (3.5 kDa MWCO) |
Thermo Scientific |
PI69552 |
| 100mg SEP-PAK C18 column |
Waters |
wat043395 |
| C18 StageTips |
Thermo Scientific |
SP301 |
| Zeba Spin Desalting Column |
Thermo Scientific |
89889 |
| NuPAGE Novex 12% Bis-Tris Protein Gels |
Fisher Scientific |
NPO343BOX |
| 4–20% Mini-PROTEAN Gels |
Bio-Rad |
4561096 |
| Syringe Filters, PES, 0.45 μm |
Genesee Scientific |
25-246 |
