Table 1. Guide RNAs used to target excision of Pdcd2l exons 1-3.
| Guide RNAs | Upstream of exon 1 | Downstream of exon 3 |
|---|---|---|
| AAAATAAAATAAGCCGGGTG | TCACTTTTATTCCACGTATA |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.