Table 1.

Summary of expression patterns, mutations, perturbations, and diseases associated with alx genes across different deuterostome phyla.

Organism	Gene	Expression Pattern	Reference	Mutation/Perturbation	Disease/Mutational Effect	Reference
Human	alx1	n.d.	n.d.	Whole-gene deletion and homozygous homeodomain splice-site mutation (c.531+1G>A)	Frontonasal dysplasia, characterized by microphthalmia and severe facial clefting	Uz et al., 2010
				Reciprocal translocation t(1;12)(p32.1;q21.3) resulting in enhanced gene expression	Microcephaly, language impairment, and mental retardation	Liao et al., 2011
	alx3	n.d.	n.d.	Nonsense (c.543T>A; p.Y191X), frameshift (c.578_581delCTGA; p.T193RfsX137), and splice-site (c.595-2A>T) mutations within homeodomain	Frontonasal dysplasia (frontorhiny)	Twigg et al., 2009
				Nonsense mutation within homeodomain (c.604C>T; p.Q202X), resulting in premature stop	Frontonasal dysplasia (frontorhiny)	Ullah et al., 2018
	alx4	n.d.	n.d.	Deletion and insertion mutation (c.1080_1089delGACCCGGTGCinsCTAAGATCTCAACAGAGATGGCAACT; p.D326fsX21), resulting in frameshift and loss of OAR domain	Mild frontonasal dysplasia and enlarge parietal foramina	Bertola et al., 2013
				Deletions (c.385_394del, c.417_418del), point mutation (c.620C>A), and duplication (c.456_465dup)	Enlarged parietal foramina	Mavrogiannis et al., 2006
				Deletion (c.504delT; p.D169X), resulting in premature stop and loss of homeodomain; point mutation in homeodomain (c.815G>C; p.R272P)	Enlarged parietal foramina	Wuyts et al., 2000
				Nonsense mutation (c.793C>T; p.R265X)	Frontonasal dysplasia	Kayserili et al., 2009
				Point mutation (c.653G>A; p.R218Q) in homeodomain nuclear localization signal	Enlarged parietal foramina	Valente et al., 2004
				Deletion (c.291delG; p.Q98SfsX83) resulting in frameshift and premature stop	Frontonasal dysplasia	El-Ruby et al., 2018
				Point mutations (c.19G_T; p.V7F, c.631A>G; p.K211E, c.917C>T; p.P306L)	Nonsyndromic craniosynostosis	Yagnik et al., 2012
Mouse	alx1	Craniofacial region (frontonasal head mesenchyme), lateral plate mesoderm, and limb bud mesenchyme	Beverdam and Meijlink, 2001; Zhao et al., 1994	Homozygous null mutant	Acrania and anencephaly	Zhao et al., 1996
	alx3 and alx4	Overlapping expression in the craniofacial region (frontonasal head mesenchyme), lateral plate mesoderm, and limb bud mesenchyme. alx3 is expressed in parts of the developing urogenital system. alx4 is expressed in hair follicles and dental papillae of teeth.	Qu et al., 1997a; Hudson et al., 1998; ten Berge et al., 1998	Homozygous double alx3/alx4 mutant	Frontonasal dysplasia and preaxial polydactyly	Beverdam et al., 2001
Zebrafish	alx1, alx3, alx4a, and alx4b	Overlapping expression in the frontonasal mesenchyme, periocular mesenchyme, mandible arch, and the prospective palate. alx1 is expressed in the head mesoderm.	Dee et al., 2013; Wang et al., 2019	Knockdown using alx1 antisense morpholino oligonucleotide	Defective neural crest migration and craniofacial malformations	Dee et al., 2013
				Knockdown using alx3 antisense morpholino oligonucleotide	No significant effect	Dee et al., 2013
Cattle	alx4	n.d.	n.d.	Duplication (c.714_734dupTCACCGAGGCCCGCGTGCAG) within the homeodomain	Tibial hemimelia syndrome	Brenig et al., 2015
Cat	alx1	n.d.	n.d.	In frame deletion of homeodomain sequences (c.496_507delCTCTCAGGACTG)	Frontonasal dysplasia	Lyons et al., 2016
Frog	alx1 and alx4	Frontal mesenchyme near the eyes	McGonnell et al., 2011	n.d.	n.d.	n.d.
Chicken	alx1 and alx4	Craniofacial region (frontonasal head mesenchyme)	Bothe et al., 2011; McGonnell et al., 2011	n.d.	n.d.	n.d.
Lamprey	alx	Trabecular cartilaginous elements near the eye, upper lip mesenchyme and parts of the branchial basket cartilage	Cattell et al., 2011; Kuratani et al., 2016; Square et al., 2017	n.d.	n.d.	n.d.
Lancelet	alx	Paraxial mesoderm, pharyngeal arch mesoderm, and gut diverticulum	Meulemans and Bronner-Fraser, 2007	n.d.	n.d.	n.d.
Thin-spined sea urchin	alx1	Primary mesenchyme cells in embryos and juvenile skeletogenic centers in late stage larvae	Ettensohn et al., 2003;	Knockdown using alx1 antisense morpholino oligonucleotide	Loss of skeletogenic cell specification	Ettensohn et al., 2003
			Gao and Davidson, 2008	Overexpression of Alx1 via mRNA microinjection into fertilized eggs	Ectopic activation of the skeletogenic program in mesodermal lineage cells	Ettensohn et al., 2003
	alx4	Primary mesenchyme cells and coelomic mesoderm in embryos	Rafiq et al., 2012; Koga et al., 2016	n.d.	n.d.	n.d.
Pencil urchin	alx1	Skeletogenic mesenchyme lineage cells	Erkenbrack and Davidson, 2015	Knockdown using alx1 antisense morpholino oligonucleotide	Loss of skeletogenic cell specification	Erkenbrack and Davidson, 2015
Sea star	alx1	Juvenile skeletogenic centers in late stage larvae	Gao and Davidson, 2008	Overexpression of Alx1 via mRNA microinjection into fertilized eggs	Upregulation of sea star orthologues of sea urchin skeletogenic genes during embryogenesis	Koga et al., 2016
Sea cucumber	alx1	Skeletogenic mesenchyme lineage cells	McCauley et al., 2012	Knockdown using alx1 antisense morpholino oligonucleotide	Loss of skeletogenic cell specification	McCauley et al., 2012
Brittle star	alx1	Skeletogenic mesenchyme lineage cells and adult skeletogenic centers in juveniles	Czarkwiani et al., 2013; Koga et al., 2016	n.d.	n.d.	n.d.
Acorn worm	alx	Coelomic mesoderm	Koga et al., 2016	n.d.	n.d.	n.d.

n.d., not determined.