A) Structure of the wild type Nsd2 locus, the targeted locus (Nsd2loxSET/FRT), the targeted locus after FLP-recombination mediated deletion of the NeoR-cassette (Nsd2loxSET/loxSET), and the SET-domain deleted locus after Cre-recombination (Nsd2ΔSET/ΔSET). Numbered rectangles depict exons, filled triangles and circles represent loxP and FRT sites, respectively. Restriction sites and distances are indicated above each locus. The 5’ and 3’ probes used in Southern blots are shown as grey bars. B) Nsd2 expression profile in different B cell populations purified from 6-12 weeks old mice was determined by qPCR and normalized to Tbp using primer pairs tcatgggaaacacaattcagca/ aagtagcttcaaagggtgtcg and gctctggaattgtaccgcag/ctggctcatagctcttggctc for Nsd2 and Tbp, respectively. Bone marrow (BM) pro-B cells (pro B), pre-B cells (pre B), immature B cells (immature B), splenic (Spl) transitional 1 B cells (T1), transitional 2 B cells (T2), marginal zone B cells (MZ B), follicular B cells (Fol B), lymph node (LN) B cells (B), peritoneal cavity (PeC) B1a cells (Bia), recirculating B cells (recirc B). A representative experiment out of 3 performed (3 biological and 3 technical replicates each). C) Nsd2 expression is upregulated upon B cell activation in vitro. Purified splenic B cells were stimulated with different agents for up to 96 hours and RNA level of the gene of interest was measured at 4, 24, 48, and 96 hours. A representative experiment out of 3 performed (3 biological and 3 technical replicates each). D) Mb1Cre- and Vav1Cre- mediated deletion of the SET-domain encoding exons 18 and 19 of the Nsd2 gene in splenic B cells. Southern blot analysis of DNA isolated from purified B cell with the 5’ probe after BsoBI digest is shown. The 7.7 kb band corresponds to the targeted locus (fl/fl) and the 14 kb and the 10.9 kb bands correspond to the wild type (+/+) and Cre modified Nsd2 gene, respectively. A representative experiment out of 2 performed (no technical replicates). E) Whole-transcriptome profile of Nsd2 gene in splenic B cells isolated from Nsd2loxSET/loxSET (WT) and Mb1creNsd2loxSET/loxSET (NSD2ΔSET) mice. IGV tracks show the relative RNA expression level. Exons 18 and 19 encoding the SET domain are boxed. A representative experiment out of 3 performed (no technical replicates). F) Truncated NSD2ΔSET protein is less stable compared to its full-length counterpart in purified splenic B cells from Nsd2loxSET/loxSET (fl/fl), Mb1creNsd2loxSET/loxSET (Mb1cre) and Vav1creNsd2loxSET/loxSET (Vavcre) mice. Exons 18 and 19 encode for 83 amino acids, which are missing in NSD2ΔSET. A representative experiment out of 2 performed (no technical replicates).