KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Phospho-EGF Receptor (Tyr1068) (D7A5) XP Rabbit mAb | Cell Signaling Technology | RRID:AB_2096270 |
| EGF Receptor | Cell Signaling Technology | RRID:AB_331707 |
| Phospho-Met (Tyr1234/1235) | Cell Signaling Technology | RRID:AB_331713 |
| Met (D1C2) XP Rabbit mAb | Cell Signaling Technology | RRID:AB_10858224 |
| Phospho-p44/42 MAPK (Erk1/2) (Thr202/Tyr204) (197G2) Rabbit mAb | Cell Signaling Technology | RRID:AB_331775 |
| p44/42 MAPK (Erk1/2) (137F5) Rabbit mAb | Cell Signaling Technology | RRID:AB_390779 |
| Spry2 (D3G1A) Rabbit mAb | Cell Signaling Technology | RRID:AB_2798658 |
| Phospho-FRS2-alpha (Tyr436) | Cell Signaling Technology | RRID:AB_2231950 |
| FGF Receptor 1 (D8E4) XP Rabbit mAb | Cell Signaling Technology | RRID:AB_11178519 |
| FGF Receptor 3 (C51F2) | Cell Signaling Technology | RRID:AB_2246903 |
| Phospho-NF-KappaB p65 (Ser536) (93H1) Rabbit mAb | Cell Signaling Technology | RRID:AB_331284 |
| NF-kappaB p65 (D14E12) XP Rabbit mAb | Cell Signaling Technology | RRID:AB_10859369 |
| Phospho-FRA1 (Ser265) (D22B1) Rabbit mAb | Cell Signaling Technology | RRID:AB_10835210 |
| Phospho-Akt (Ser473) | Cell Signaling Technology | RRID:AB_2315049 |
| Akt antibody | Cell Signaling Technology | RRID:AB_329827 |
| c-Jun (60A8) Rabbit mAb | Cell Signaling Technology | RRID:AB_2130165 |
| HA-Tag (6E2) Mouse mAb | Cell Signaling Technology | RRID:AB_10691311 |
| GAPDH (6C5) antibody | Santa Cruz Biotechnology | RRID:AB_627679 |
| Goat Anti-Mouse IgG Antibody, IRDYE700DX Conjugated | Rockland Immunochemicals | RRID:AB_220121 |
| Goat Anti-RABBIT IgG Antibody DyLight 800 Conjugated | Rockland Immunochemicals | RRID:AB_1660964 |
| Goat anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 | Thermo Fisher Scientific | RRID:AB_2534079 |
| Normal Rabbit IgG antibody | Cell Signaling Technology | RRID:AB_1031062 |
| Bacterial and Virus Strains | ||
| Subcloning Efficiency DH5α | Thermo Fisher Scientific | Cat # 18265017 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Gefitinib | LC Laboratories | Cat # G-4408 |
| PHA665752 | Santa Cruz Biotechnology | Cat # sc-203186 |
| CI-1040 | LC Laboratories | Cat # P-8499 |
| PD173074 | ApexBio | Cat # A8253 |
| JNJ-38877605 | Selleck Chemicals | Cat # S1114 |
| IKK-16 | Selleck Chemicals | Cat # S2882 |
| crizotinib | Cell Signaling Technology | Cat # 4401 |
| trametinib | ApexBio | Cat # A3018 |
| AZD4547 | ApexBio | Cat # A8350 |
| BGJ398 | ApexBio | Cat # A3014 |
| Recombinant human FGF1 | Peprotech | Cat # 100–17A |
| Recombinant human FGF2 | Peprotech | Cat # AF-100–18B |
| Recombinant human EGF | Peprotech | Cat # AF 100–15 |
| D-luciferin | Gold Biotechnology | Cat # LUCNA-1G |
| TO-PRO-3 | Thermo Fisher Scientific | Cat # T3605 |
| Lipofectamine™ RNAiMAX | Thermo Fisher Scientific | Cat # 13778500 |
| Puromycin | Gemini Biosciences | Cat # 400–128P |
| Hygromycin B | Gemini Biosciences | Cat #400–123 |
| Critical Commercial Assays | ||
| SimpleChIP® Enzymatic Chromatin IP Kit | Cell Signaling Technology | Cat # 9003 |
| PathScan RTK Signaling Antibody Array Kit | Cell Signaling Technology | Cat # 7949 |
| Human FGF-acidic Quantikine ELISA kit | R&D Systems | Cat # DFA00B |
| CellTiter 96® AQueous Non-Radioactive Cell Proliferation Assay (MTS) | Promega | Cat # G5421 |
| Pierce BCA Protein Assay Kit | Thermo Fisher Scientific | Cat # 23225 |
| Experimental Models: Cell Lines | ||
| U87MG stably expressing EGFRvIII (referred to as U87MG herein) | Dr. Frank Furnari | N/A |
| U251 | Dr. Gary Kuo | N/A |
| U118MG | ATCC | RRID:CVCL_0633 |
| T98G | ATCC | RRID:CVCL_0556 |
| G88 | (Mineo et al., 2016) | N/A |
| G2 | (Mineo et al., 2016) | N/A |
| T3691 | (Mathew et al., 2014) | N/A |
| Amphotropic Phoenix cells | Dr. Gary Nolan | N/A |
| 293FT | ATCC | RRID:CVCL_6911 |
| Experimental Models: Organisms/Strains | ||
| NU/NU Nude mouse | Charles River | Strain code: 088 |
| BALB/c scid mouse | The Jackson Laboratory | Stock No: 001803 |
| Oligonucleotides | ||
| pLKO.1-control shRNA; targeting sequence: ATCACAGAATCGTCGTATGCA | This paper; See Table S1 | N/A |
| pLKO.1-FGFR3 shRNA-A; targeting sequence: TGCGTCGTGGAGAACAAGTTT | This paper; See Table S1 | N/A |
| pLKO.1-FGFR3 shRNA-B; targeting sequence: GACAAGGAGCTAGAGGTTCTC | This paper; See Table S1 | N/A |
| pSicoR-control shRNA; targeting sequence: GTCATATAGACCATAGTTA | (Walsh et al., 2015); See Table S1 | N/A |
| pSicoR-SPRY2 shRNA; targeting sequence: GATGCATATGTCCAATATA | (Walsh et al., 2015); See Table S1 | N/A |
| siRNA targeting FGFR1 | Thermo Fisher Scientific; See Table S2 | Cat # AM51331 |
| siRNA targeting FGFR3, c-Jun, NF-κB | Santa Cruz Biotechnology; See Table S2 | Cat # sc-29314, sc-29223, sc-29410 |
| siRNA targeting SPRY2 | Dharmacon (GE); See Table S2 | Cat # M-005206–01 |
| qRT-PCR primers | This paper; See Table S3 | N/A |
| NF-kB ChIP primers for FGF1 promoter | This paper; See Table S4 | N/A |
| Single-molecule RNA FISH probes for SPRY2 and FGF2 | Dr. Arjun Raj; See Table S5 for complete sequences | Stellaris |
| Recombinant DNA | ||
| pSicoR-puro | Dr. Tyler Jacks | N/A |
| pLKO.1-puro | Broad Institute, The RNAi Consortium | N/A |
| pMSCV-NLS-mVenus-FIRE-puro | (Albeck et al., 2013) | N/A |
| pMSCV-NLS-mCerulean-d2-hygro | This paper | N/A |
| pMSCV-NLS-CBGreen-FIRE-puro | This paper | N/A |
| pMSCV-NLS-CBRed-d2-hygro | This paper | N/A |
| pBABE-puro-FGFR3c-WT | (Liao et al., 2013) | Addgene #45711 |
| pBABE-HA-SPRY2-hygro | This paper | N/A |
| pBABE-SPRY2-hygro | This paper | N/A |
| pHM6-HA-SPRY2 | (Yigzaw et al., 2001) | N/A |
| pCMV-VSVg | Dr. Mehul Shah | N/A |
| pMDL-gp-RRE | Dr. Mehul Shah | N/A |
| pRSV-Rev | Dr. Mehul Shah | N/A |
| pNB777 | (Mazo-Vargas et al., 2014) | Addgene #60153 |
| pNB778 | (Mazo-Vargas et al., 2014) | Addgene #60154 |
| Software and Algorithms | ||
| ImageJ | Schneider et al., 2012 | https://imagej.nih.gov/ij/ |
| Living Image version 4.4.5 | Perkin Elmer | RRID:SCR_014247 |
| StarSearch RNA FISH software | Dr. Arjun Raj | https://rajlab.seas.upenn.edu/StarSearch/launch.html |
| Image Studio software version 5.2.5 | LI-COR | RRID:SCR_015795 |