KEY RESOURCE TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse Monoclonal anti-RbAp48 | GeneTex | Cat#GTX70232; RRID:AB_372869 |
| Rabbit Polyclonal anti-RbAp48 | Thermo Fisher Scientific | Cat#PA1–869; RRID:AB_2177636 |
| Mouse Monoclonal anti-β-Tubulin I | Sigma-Aldrich | Cat#T7816; RRID:AB_261770 |
| Mouse monoclonal anti-Osteocalcin | Millipore | Cat#MABD123 |
| Rabbit polyclonal anti-BDNF (N-20) | Santa Cruz Biotechnology | Cat#sc-546; RRID:AB_630940 |
| Mouse monoclonal anti-CBP (C-1) | Santa Cruz Biotechnology | Cat#sc-7300; RRID:AB_626817 |
| Rabbit polyclonal anti-CBP (C-20) | Santa Cruz Biotechnology | Cat#sc-583; RRID:AB_2245237 |
| Rabbit Polyclonal anti-GPR158 | GeneTex | Cat#GTX87693; RRID:AB_10723755 |
| Goat polyclonal anti-Osteocalcin | Thermo Fisher Scientific | Cat#PA1–85754; RRID:AB_2065062 |
| Mouse monoclonal anti-PSD-95 | UC Davis/NIH NeuroMab Facility | Cat#75–028; RRID:AB_2292909 |
| Chicken polyclonal anti-MAP2 | Abeam | Cat#ab5392; RRID:AB_2138153 |
| Chicken polyclonal anti-GFP | Abeam | Cat#ab13970; RRID:AB_300798 |
| Rabbit polyclonal anti-GFP | Invitrogen | Cat#A-11122; RRID:AB_221569 |
| Chicken polyclonal anti-mCherry | Abeam | Cat#ab205402; RRID:AB_2722769 |
| Chicken polyclonal anti-BDNF | Promega | Cat#G1641; RRID:AB_430850 |
| Rabbit polyclonal anti-KAT3A/CBP | Abeam | Cat#ab2832; RRID:AB_303342 |
| Guinea pig polyclonal anti-Parvalbumin | Swant | Cat#GP72; RRID:AB_2665495 |
| Streptavidin, Alexa Fluor 647 conjugate antibody | Thermo Fisher Scientific | Cat#S-21374; RRID:AB_2336066 |
| Bacterial and Virus Strains | ||
| T7 Express Competent E. coli (High Efficiency) | New England BioLabs | Cat#C2566l |
| Chemicals, Peptides, and Recombinant Proteins | ||
| His-tagged Osteocalcin | This paper | N/A |
| FuGENE 6 Transfection Reagent | Promega | Cat#E2691 |
| Lipofectamine 2000 | Life Sciences | Cat#11668019 |
| Critical Commercial Assays | ||
| LowCell ChIP Kit | Diagenode | Cat#C01010071 |
| iPURE Kit v2 | Diagenode | Cat#C03010015 |
| RNA Easy Mini Kit | QIAGEN | Cat#74104 |
| QuikChange Lightning | Agilent | Cat#210515 |
| Ni-NTA Fast Start Kit | QIAGEN | Cat#30600 |
| RFP-Trap_MA Kit | Chromotek | Cat#rtmak-20 |
| Supersignal Western Blot Enhancer Kit | ThermoFisher | Cat#46640 |
| Deposited Data | ||
| ChIP-seq data | Short Read Archive | SRA: SRP141688 |
| Experimental Models: Cell Lines | ||
| Human: HEK293FT | ThermoFisher | RRID:CVCL_6911 |
| Mouse: Neuronal cultures from P0 pups | This Paper | N/A |
| Experimental Models: Organisms/Strains | ||
| Mouse: c57/BL6 | The Jackson Laboratory | RRID:IMSR_JAX:000664 |
| Mouse: c57/BL6 | Taconic Biosciences | RRID:IMSR_TAC:b6 |
| Mouse: tetO-Flag RbAp48-DN | Pavlopoulos et al., 2013 | N/A |
| Mouse: CaMKIIa-tTA | Pavlopoulos et al., 2013 | N/A |
| Mouse: c-Fos-CreERT2 | The Jackson Laboratory | RRID:IMSR_JAX:021882 |
| Mouse: tdTomato (Ai14) | The Jackson Laboratory | RRID:IMSR_JAX:007914 |
| Mouse: NestinCreERT2/Rosa26/EYFP | Dr. Alex Dranovsky (Dranovsky et al., 2011) | N/A |
| Oligonucleotides | ||
| GFP targeting sequence: GCAAGCTGACCCTGAAGTTCAT | This paper | N/A |
| GPR158 targeting sequence: GCTCATTATCACGGCTATATT | This paper | N/A |
| Recombinant DNA | ||
| Plasmid: pRSET expression vector | Invitrogen | Cat#V35120 |
| Plasmid: mStrawberry | Clontech | Cat#632530 |
| Plasmid: GPR158 ORF | DNASU | Clone: MmCD00081142 |
| Plasmid: pAc-GFP1-N | Clontech | Cat#632485 |
| Plasmid: pAc-GFP1-C | Clontech | Cat#630458 |
| Plasmid: pSICO | Ventura et al., 2004 | Addgene Plasmid #11578 |
| Plasmid: pSICOR | Ventura et al., 2004 | Addgene Plasmid #11579 |
| Plasmid: pmCherry-N1 | Clontech | Cat#632523 |
| Plasmid: pMDLg/pRRE | Dull et al., 1998 | Addgene Plasmid #12251 |
| Plasmid: pRSV-REV | Dull et al., 1998 | Addgene Plasmid #12253 |
| Plasmid: pCMV-VSV-G | Dull et al., 1998 | Addgene Plasmid #8454 |
| Software and Algorithms | ||
| Ethovision | Noldus | RRID:SCR_000441 |
| Med Associates Video Freeze Software | Med Associates Inc. | RRID:SCR_014574 |
| FASTX-Toolkit | Cold Spring Harbor Laboratory | RRID:SCR_005534 |
| Bowtie2 | Langmead et al., 2009 | RRID:SCR_016368 |
| Samtools (version 0.1.19) | Li et al., 2009 | RRID:SCR_002105) |
| MACS14 algorithm | Zhang et al., 2008 | RRID:SCR_013291 |
| IGV browser | Nicol et al., 2009 | http://bioviz.org/ |
| DAVID | Huang et al., 2009 | https://david.ncifcrf.gov/gene2gene.jsp |
| ImageJ | ImageJ | RRID:SCR_003070 |
| LI-COR Image Studio Software | LI-COR | RRID:SCR_015795 |
| Graphpad Prism 6 | Graphpad | RRID:SCR_002798 |