Table 2.
Custom Primers Used for Real-Time PCR
| Gene symbol | Accession number | Forward primer | Reverse primer | Amplicon (nt) |
|---|---|---|---|---|
| Ihh | NM_010544 | tgcattgctctgtcaagtctg | gctccccgttctctaggc | 93 |
| Ipo8 | NM_001081113.1 | cacattgtcgctcgtctctt | acctgttgaattcccactgc | 112 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.