Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain (Saccharomyces cerevisiae) |
AH109 | Clontech | Reporters: HIS3,
ADE2, MEL1, LacZ |
|
| Cell line (Homo sapiens) |
HEK293 | ATCC | Cat# PTA-4488, RRID:CVCL_0045 |
|
| Cell line (H. sapiens) |
ARPE19 | ATCC | Cat# CRL-2302, RRID:CVCL_0145 |
|
| Cell line (Mus musculus) |
NIH3T3 fibroblast cell line | ATCC | Cat# CRL-1658, RRID:CVCL_0594 |
|
| Transfected construct | pEGFP-N1 | Clontech | Cat# 6085–1 | |
| Transfected construct (Rattus norvegicus) |
pEGFP-N1 AKAP6β | This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP-N1 AKAP6βsiRNA res | This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP -C2 AKAP6 -SR1-3 (585–1286) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP -C2 AKAP6 -SR1-2 (585–1065) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP -C2 AKAP6 -SR1 (585–915) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP -C2 AKAP6 -SR2 (915–1065) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pEGFP -C2 AKAP6 -SR3 (1065–1286) |
This paper | N/A | |
| Transfected construct (Mus musculus) |
pmCherry-Nesprin1α | This paper | N/A | |
| Transfected construct (H. sapiens) |
pCMV-Tag2b-hAKAP9-CTermin | This paper | N/A | |
| Transfected construct (H. sapiens) |
pCMV-Tag2b-hPCNT-CTermin | This paper | N/A | |
| Transfected construct (H. sapiens) |
pDsRed-PACT-Myc | Mikule et al., 2007 | ||
| Transfected construct (H. sapiens) |
GFP-FLAG-PcntB-Myc | Lee and Rhee, 2012 | ||
| Transfected construct | pGBKT7 | Clontech | Cat# 630443 | |
| Transfected construct (Rattus norvegicus) |
pGBKT7-AKAP6-SR1(585–915) | This paper | N/A | |
| Transfected construct | pGADT7 | Clontech | Cat# 630442 | |
| Transfected construct (H. sapiens) |
pGADT7-Pcnt-PACT | This paper | N/A | |
| Transfected construct (H. sapiens) |
pGADT7-AKAP9-PACT | This paper | N/A | |
| Transfected construct | pmCherry-Farnesyl5 | Addgene | Cat# 55045 | |
| Transfected construct | tdTomato-Farnesyl5 | Addgene | Cat# 58092 | |
| Transfected construct (Rattus norvegicus) |
tdTomato-SR1- Farnesyl5(585-915) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pmCherry-Farnesyl5 -SR1(585–915) |
This paper | N/A | |
| Transfected construct (Rattus norvegicus) |
pENTR1-SR1(585–915) | This paper | N/A | |
| Transfected construct (H. sapiens) |
pEGFP-C2-AKAP9-1KB | This paper | N/A | |
| Transfected construct | FAPP-PH-GFP | Balla et al., 2005 | ||
| Biological sample (Rattus norvegicus) |
E15 cardiomyocytes | This paper | N/A | |
| Biological sample (Rattus norvegicus) |
P3 cardiomyocytes | This paper | N/A | |
| Biological sample (H. sapiens) |
Osteoclasts | This paper | N/A | |
| Antibody | anti-PCM1 (H-262) (rabbit polyclonal) |
Santa Cruz Biotechnology |
Cat# sc-67204, RRID:AB_2139591 |
IF: (1:500) WB: (1:1000) |
| Antibody | anti-PCM1 (G-6) (mouse monoclonal) |
Santa Cruz Biotechnology |
Cat# sc-398365, RRID:AB_2827155 |
IF: (1:500) |
| Antibody | anti-AKAP6 (rabbit polyclonal) |
Sigma-Aldrich | Cat# HPA048741, RRID:AB_2680506 |
IF: (1:500) WB: (1:1000) |
| Antibody | anti-AKAP6 (mouse monoclonal) |
Covance Research Products Inc |
Cat# MMS-448P-100, RRID:AB_10094719 |
IF: (1:500) |
| Antibody | anti-AKAP6 (rabbit polyclonal) |
M.S. Kapiloff (Li et al., 2013) |
IF: (1:1000) | |
| Antibody | anti-Pericentrin (rabbit polyclonal) |
BioLegend | Cat# PRB-432C, RRID:AB_291635 |
IF: (1:500) |
| Antibody | anti-Pericentrin (mouse monoclonal) |
Abcam | Cat# ab220784 | IF: (1:500) |
| Antibody | anti-nesprin-1 (MANNES1E) (mouse monoclonal) |
G. Morris (Randles et al., 2010) |
N/A | IF: (1:100) |
| Antibody | anti-nesprin-1 (rabbit polyclonal) |
Covance | Cat# PRB-439P-100, RRID:AB_10094891 |
IF: (1:500) |
| Antibody | anti-α-tubulin (mouse monoclonal) |
Sigma-Aldrich | Cat# T9026, RRID:AB_477593 |
WB:(1:1000) |
| Antibody | anti-tubulin (rat monoclonal) |
Abcam | Cat# ab6160, RRID:AB_305328 |
IF: (1:500) |
| Antibody | anti-Troponin I (goat polyclonal) |
Abcam | Cat# ab56357, RRID:AB_880622 |
IF: (1:500) |
| Antibody | anti-γ-tubulin (mouse monoclonal) |
Santa Cruz Biotechnology |
Cat# sc-51715, RRID:AB_630410 |
IF: (1:100) |
| Antibody | anti-ninein (mouse monoclonal) |
Santa Cruz Biotechnolgy |
Cat# sc-376420, RRID:AB_11151570 |
IF: (1:100) |
| Antibody | anti-AKAP9 (rabbit polyclonal) |
Sigma-Aldrich | Cat# HPA026109, RRID:AB_1844688 |
IF: (1:500) |
| Antibody | anti-AKAP9 (mouse monoclonal) |
BD Biosciences | Cat# 611518, RRID:AB_398978 |
IF: (1:250) |
| Antibody | anti-GM130 (mouse monoclonal) |
BD Biosciences | Cat# 610823, RRID:AB_398142 |
IF: (1:500) |
| Antibody | anti-Atrial Natriuretic Peptide (ANF) (rabbit polyclonal) |
Millipore | Cat# AB5490, RRID:AB_2155601 |
IF: (1:500) |
| Antibody | anti-GFP (mouse monoclonal) | Roche | Cat# 11814460001, RRID:AB_390913 |
IF: (1:1000) WB: (1:1000) |
| Antibody | anti-GFP (rabbit polyclonal) | Novus | Cat# NB600-308, RRID:AB_10003058 |
IF: (1:1000) WB: (1:1000) IP: (1.5 µl) |
| Antibody | anti-FLAG (mouse monoclonal) | Sigma-Aldrich | Cat# F1804, RRID:AB_262044 |
IF: (1:2000) WB: (1:1000) IP: (1.5 µl) |
| Antibody | anti-Myc (mouse monoclonal) | Cell Signaling Technology |
Cat# 2276, RRID:AB_331783 |
IF: (1:1000) |
| Antibody | anti-Rabbit secondary antibody, Alexa Fluor 488 (donkey) |
Thermo Fisher Scientific |
Cat# A-21206, RRID:AB_2535792 |
IF: (1:250) |
| Antibody | anti-Rabbit secondary antibody, Alexa Fluor 594 (donkey) |
Thermo Fisher Scientific |
Cat# A21207, RRID:AB_141637 |
IF: (1:250) |
| Antibody | anti-Rabbit secondary antibody, Alexa Fluor 647 (donkey) |
Thermo Fisher Scientific |
Cat# A31573, RRID:AB_2536183 |
IF: (1:250) |
| Antibody | anti-Mouse secondary antibody, Alexa Fluor 488 (donkey) |
Thermo Fisher Scientific |
Cat# A21202, RRID:AB_141607 |
IF: (1:250) |
| Antibody | anti-Mouse secondary antibody, Alexa Fluor 594 (donkey) |
Thermo Fisher Scientific |
Cat# A21203, RRID:AB_2535789 |
IF: (1:250) |
| Antibody | anti-Mouse secondary antibody, Alexa Fluor 647 (donkey) |
Thermo Fisher Scientific |
Cat# A31571, RRID:AB_162542 |
IF: (1:250) |
| Antibody | anti-Goat secondary antibody t, Alexa Fluor 594 (donkey) |
Thermo Fisher Scientific |
Cat# A32758, RRID:AB_2762828 |
IF: (1:250) |
| Antibody | anti-Goat secondary antibody, Alexa Fluor 647 (donkey) |
Thermo Fisher Scientific |
Cat# A21447, RRID:AB_2535864 |
IF: (1:250) |
| Antibody | anti-rat secondary antibody, Alexa Fluor 488 (donkey) |
Thermo Fisher Scientific |
Cat# A-21208, RRID:AB_2535794 |
IF: (1:250) |
| Antibody | anti-rat secondary antibody, Alexa Fluor 594 (donkey) |
Thermo Fisher Scientific |
Cat# A-21209, RRID:AB_2535795 |
IF: (1:250) |
| Antibody | ECL Mouse IgG, HRP-linked whole Ab (sheep) |
GE Healthcare | Cat# NA931, RRID:AB_772210 |
WB: (1:5000) |
| Antibody | ECL Rabbit IgG, HRP-linked whole Ab (sheep) |
GE Healthcare | Cat# NA934, RRID:AB_772206 |
WB: (1:5000) |
| Sequence-based reagent | Silencer Select Negative Control No. one siRNA |
Thermo Fischer Scientific |
Cat# 4390843 | |
| Sequence-based reagent (Rattus norvegicus) |
siRNA targeting sequence: rat Akap6 |
Thermo Fischer Scientific |
Cat# 4390771 s134273 |
CAAACGACCUUGAUCAAGAtt |
| Sequence-based reagent (Rattus norvegicus) |
siRNA targeting sequence: rat Akap9 |
Thermo Fischer Scientific |
Cat# 4390771 s97685 |
GCUUGAACAUGCGAAAGUUtt |
| Sequence-based reagent |
shRNA targeting sequence: rat/mouse/ human Akap6 |
This paper | N/A | CGTTTGATTTGCCTCTGCAGC |
| Sequence-based reagent |
Pcnt FlexiTube siRNA | Qiagen | Cat# SI01709351 | CAGGAACUCACCAGAGACGAA |
| Sequence-based reagent (Rattus norvegicus) |
Akap6 RT-PCR | This paper | Forward primer: | GGGTGATTTGTTTGGATTGG |
| Sequence-based reagent (Rattus norvegicus) |
Akap6 RT-PCR | This paper | Reverse primer: | TGTCAGAAACACTCCGCTTG |
| Sequence-based reagent (Rattus norvegicus) |
Gapdh RT-PCR | This paper | Forward primer: | CAG AAG ACT GTG GAT GGC CC |
| Sequence-based reagent (Rattus norvegicus) |
Gapdh RT-PCR | This paper | Reverse primer: | AGT GTA GCC CAG GAT GCC CT |
| Commercial assay or kit | Cold Fusion Cloning Kit with Competent Cells |
System Biosciences | Cat# MC010B-1 | |
| Commercial assay or kit | Neonatal Heart Disassociation Kit |
Miltenyi Biotec | Cat# 130-098-373 | |
| Commercial assay or kit | M-MLV Reverse Transcriptase |
Sigma | Cat# M1302 | |
| Commercial assay or kit | Lipofectamine LTX | Thermo Fisher Scientific |
Cat# 15338100 | |
| Commercial assay or kit | Lipofectamine RNAiMAX | Thermo Fisher Scientific |
Cat# 13778150 | |
| Chemical compound, drug |
Nocodazole | Sigma-Aldrich | Cat# M1404 | |
| Chemical compound, drug |
Brefeldin A (BFA) | Sigma-Aldrich | Cat# B7651 | |
| Chemical compound, drug |
Endothelin 1 (ET-1) |
Sigma-Aldrich | Cat# E7764 | |
| Chemical compound, drug |
Fibronectin | Sigma-Aldrich | Cat# F1141 | |
| Chemical compound, drug |
4’,6-diamidino-2- phenylindole (DAPI) |
Carl Roth | Cat# 6335.1 | |
| Chemical compound, drug |
Fluoromount-G | Thermo Fisher Scientific |
Cat# 00-4958-02 | |
| Chemical compound, drug |
Dulbecco's Modified Eagle Medium (DMEM), high glucose, GlutaMAX |
Thermo Fisher Scientific |
Cat# 61965059 | |
| Chemical compound, drug |
DMEM 199 medium | Thermo Fisher Scientific |
Cat# 41150 | |
| Chemical compound, drug |
Iscove's Modified Dulbecco's Medium (IMDM), GlutaMAX Supplement |
Thermo Fisher Scientific |
Cat# 31980 | |
| Chemical compound, drug |
Fetal Bovine Serum (FBS) | biowest | Cat# S1810 | |
| Chemical compound, drug |
Horse Serum | Thermo Fisher Scientific |
Cat# 16050122 | |
| Chemical compound, drug |
Penicillin-Streptomycin | Thermo Fisher Scientific |
Cat# 15140122 | |
| Chemical compound, drug |
Gentamicin | Thermo Fisher Scientific |
Cat# 15750060 | |
| Chemical compound, drug |
DPBS, no calcium, no magnesium |
Thermo Fisher Scientific |
Cat# 14190094 | |
| Chemical compound, drug |
Opti-MEM I Reduced Serum Medium |
Thermo Fisher Scientific |
Cat# 11058021 | |
| Chemical compound, drug |
YPDA Broth | Clontech | Cat# 630306 | |
| Chemical compound, drug |
SD–Leu /– Trp with Agar | Clontech | Cat# 630317 | |
| Chemical compound, drug |
SD–Ade /– His /– Leu /– Trp with Agar |
Clontech | Cat# 630323 | |
| Software, algorithm | Fiji | http://fiji.sc | RRID:SCR_002285 | |
| Software, algorithm | ZEN blue | Carl Zeiss AG | RRID:SCR_013672 | |
| Software, algorithm | GraphPad Prism | GraphPad Prism, | RRID:SCR_002798 | |
| Other | Zeiss LSM800 confocal laser scanning microscope with Airyscan module |
Carl Zeiss AG | N/A | |
| Other | Leica TCS SP8 | Leica Microsystems | N/A |