Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
The primers for the sequences of CAP and ΔCAP
| Probe/primer | The DNA sequence (5′-3′) | Tm | Amplicon size (bp) |
|---|---|---|---|
| CAPF | tttt ggatcc ATGAGACACAGAGCTATATTCAG | 55.40 | 650 |
| ΔCAPF | tttt ggatcc CCCACAGCTGGCACATAC | 58.09 | 554 |
| CAPR | tttt ctcgag TTCACTTAGAGAACGGACTTG | 55.31 |
The lowercase letters are protective bases and restriction sites, respectively
