Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Homo sapiens) | GLS | GenBank | Gene ID: 2744 | |
| Strain, strain background (Mus musculus, female) | Athymic nude mice | Envigo | Athymic Nude-Foxn1nu, RRID:IMSR_JAX:007850 | |
| Cell line (Mus musculus) | Mouse embryonic fibroblasts (MEFs) | This laboratory | SV40-immortalized; confirmed mycoplasma-free | |
| Cell line (Mus musculus, female) | A20 | ATCC | TIB-208; RRID:CVCL_1940 | confirmed mycoplasma-free |
| Cell line (Mus musculus, female) | MC-38 | Dr. James Hodge laboratory | RRID:CVCL_B288 | confirmed mycoplasma-free |
| Cell line (Homo sapiens, male) | MiaPaCa2 | ATCC | CRL-1420; RRID:CVCL_0428 | Authenticated by STR; confirmed mycoplasma-free |
| Cell line (Homo sapiens, female) | A498 | Dr. James Hsieh laboratory | RRID:CVCL_1056 | Authenticated by STR; confirmed mycoplasma-free |
| Antibody | phospho-Thr899 GCN2, rabbit monoclonal | Abcam | Cat. #ab75836, RRID:AB_1310260 | (1:1000) dilution |
| Antibody | GCN2, rabbit polyclonal | Cell Signaling | Cat. #3302, RRID:AB_2277617 | (1:1000) dilution |
| Antibody | phospho-Thr-389-S6K1, rabbit monoclonal | Cell Signaling | Cat. #9234, RRID:AB_2269803 | (1:1000) dilution |
| Antibody | S6K1, rabbit monoclonal | Cell Signaling | Cat. #2708, RRID:AB_390722 | (1:1000) dilution |
| Antibody | vinculin, mouse monoclonal | Sigma-Aldrich | Cat. #V9131, RRID:AB_477629 | (1:2000) dilution |
| Antibody | ATF4, rabbit polyclonal | Santa Cruz | Cat. #sc-200, RRID:AB_2058752 | (1:250) dilution |
| Antibody | MED12, rabbit polyclonal | Bethyl | Cat. #A300-774A, RRID:AB_669756 | (1:1000) dilution |
| Antibody | TBP, rabbit polyclonal | Bethyl | Cat. #A301-229A, RRID:AB_890661 | (1:1000) dilution |
| Antibody | CBP, rabbit polyclonal | Bethyl | Cat. #A300-362A, RRID:AB_185573 | (1:1000) dilution |
| Antibody | CBFα1, rabbit monoclonal | Cell Signaling | Cat. #12556, RRID:AB_2732805 | (1:1000) dilution |
| Antibody | BRD4, rabbit monoclonal | Abcam | Cat. #ab128874, RRID:AB_11145462 | (1:1000) dilution |
| Antibody | CTCF, rabbit monoclonal | Bethyl | Cat. #A700-041-T, RRID:AB_2883994 | (1:1000) dilution |
| Antibody | RNA pol II, mouse monoclonal | Active Motif | Cat. #39497, RRID:AB_2732926 | (1:1000) dilution |
| Antibody | Histone H3, mouse monoclonal | Cell Signaling | Cat. #3638, RRID:AB_1642229 | (1:1000) dilution |
| Antibody | α-Tubulin, mouse monoclonal | Sigma-Aldrich | Cat. #T9026, RRID:AB_477593 | (1:1000) dilution |
| Antibody | β-Actin, mouse monoclonal | Sigma-Aldrich | Cat. #A5441, RRID:AB_476744 | (1:2000) dilution |
| Antibody | HA tag, mouse monoclonal | Cell Signaling | Cat. #2367, RRID:AB_10691311 | (1:1000) dilution |
| Antibody | Puromycin, mouse monoclonal | EMD Millipore | Cat. #MABE343, RRID:AB_2566826 | (1:500) dilution |
| Antibody | GLS, rabbit monoclonal | Abcam | Cat. #ab156876, RRID:AB_2721038 | (1:1000) dilution |
| Recombinant DNA reagent | pLKO.1-shCtrl1 | Gene Editing and Screening Core, MSKCC | SHC002 | Lentivirus-encoded non-targeting control shRNA |
| Recombinant DNA reagent | pLKO.1-shCtrl2 | Gene Editing and Screening Core, MSKCC | SHC007 | Lentivirus-encoded shRNA targeting luciferase |
| Recombinant DNA reagent | pLKO.1-shGLS-1 | Gene Editing and Screening Core, MSKCC | TRCN0000051136 | Lentivirus-encoded shRNA targeting human GLS |
| Recombinant DNA reagent | pLKO.1-shGLS-2 | Gene Editing and Screening Core, MSKCC | TRCN0000051135 | Lentivirus-encoded shRNA targeting human GLS |
| Recombinant DNA reagent | pTURN-hygro-GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing GFP | |
| Recombinant DNA reagent | pTURN-hygro-d2GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing d2GFP (GFP fused to a degron of mouse ODC) | |
| Recombinant DNA reagent | pTURN-hygro-PolyQ-GFP | This laboratory | Retrovirus-encoded, dox-inducible vector expressing PolyQ-GFP (GFP) fused to a first exon of human HTT; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Recombinant DNA reagent | pCDH-puro-PolyQ−1-GFP | This laboratory | Lentivirus-encoded frameshift reporter; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Recombinant DNA reagent | pCDH-puro-Luc−1-GFP | This laboratory | Lentivirus-encoded frameshift reporter control; design details in ‘Reporter Design and Virus Production’ under Materials and methods | |
| Sequence-based reagent | tRNA assay 5’-adenylated DNA adaptor | IDT DNA | 5′-/5rApp/TGGAATTCTCGGGTGCCAAGG/3ddC /- 3′ | |
| Sequence-based reagent | 5’-phosphorylated DNA adaptor for CHARGE-seq | IDT DNA | 5’-/5phos/AGATCGGAAGAGCGTCGTGTAGGGA/3ddC /- 3’ | |
| Commercial assay or kit | Click-iT Plus Alexa Fluor 647 Picolyl Azide Toolkit | Thermo Scientific | C10643 | For O-propargyl-puromycin and 5-ethynyl-uridine incorporation assay |
| Chemical compound, drug | L-Valinol | Sigma-Aldrich | 186708 | Used at 2 mM |
| Chemical compound, drug | Cycloheximide | Sigma-Aldrich | C4859 | Used at 10 μg/mL |
| Chemical compound, drug | CB-839 | Selleck Chemicals | S7655 | Used at 1 μM |
| Chemical compound, drug | Bafilomycin A1 | Cayman Chemical | 88899-55-2 | Used at 100 nM |
| Chemical compound, drug | BPTES | Cayman Chemical | 19284 | Used at 10 μM |
| Chemical compound, drug | Compound 968 | Cayman Chemical | 17199 | Used at 10 μM |
| Chemical compound, drug | ISRIB | Sigma-Aldrich | SML0843 | Used at 400 nM |
| Chemical compound, drug | O-propargyl-puromycin | Thermo Scientific | C10459 | Used at 20 μM |
| Chemical compound, drug | 5-ethynyl-uridine | Abcam | ab146642 | Used at 200 μM |
| Other | GtRNA database | PMID:26673694 | RRID:SCR_006939 | Genomic tRNA Database, http://gtrnadb.ucsc.edu |