Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| gene (Caenorhabditis
elegans) |
nsun-1 | WormBase | WBGene00021073 | Also known as: nol-1, nol-2 |
| gene (C. elegans) | nsun-5 | WormBase | WBGene00013151 | |
| strain, strain background (C. elegans) | N2 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00000001 | Genotype: wildtype |
| genetic reagent (C. elegans) | FX30263 | National Bioresource Project, Tokyo, Shohei Mitani |
Genotype: nsun-1(tm6081) II/lin-42(tmls1246) II | |
| genetic reagent (C. elegans) | JGG1 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00022241 | Genotype: nsun-5(tm3898) II |
| genetic reagent (C. elegans) | SA115 | CGC, University of Minnesota | RRID:WB-STRAIN:WB
Strain00033882 |
Genotype: unc-119(ed3) III; tjIs1 [pie-1::GFP::rho-1 + unc-119(+)] |
| genetic reagent (C. elegans) | JJ1473 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00022491 | Genotype: unc-119(ed3) III; zuIs45 [nmy-2p::nmy-2::GFP + unc-119(+)] V |
| genetic reagent (C. elegans) | TP12 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00034928 | Genotype: kaIs12[col-19::GFP] |
| genetic reagent (C. elegans) | DCL569 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00005607 | Genotype: mkcSi13 [sun-1p::rde-1::sun-1 3'UTR + unc-119(+)] II |
| genetic reagent (C. elegans) | NL2098 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00028994 | Genotype: rrf-1(pk1417) I |
| genetic reagent (C. elegans) | NL2550 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00029002 | Genotype: ppw-1(pk2505) I |
| genetic reagent (C. elegans) | JK4626 | CGC, University of Minnesota | RRID:WB-STRAIN:WBStrain00022650 | Genotype: cku-80(ok861) unc-119(ed3) III; qIs170 [gld-1p::gld-1::GFP::FLAG + unc-119(+)] |
| antibody | Anti-puromycin antibody, mouse monoclonal | Millipore | Cat# MABE343, RRID:AB_2566826 | Western Blot: (1:10000) |
| antibody | Anti-Histone H3 antibody, rabbit polyclonal | Abcam | Cat# ab1791, RRID:AB_302613 | Western Blot: (1:4000) |
| antibody | Anti-Rabbit-IR-Dye 800, donkey polyclonal | LI-COR Biosciences | Cat# 926–32213, RRID:AB_621848 | Western Blot: (1:10000) |
| antibody | Anti-Mouse-IR-Dye 680RD, donkey polyclonal | LI-COR Biosciences | Cat# 926–68072, RRID:AB_10953628 | Western Blot: (1:10000) |
| recombinant DNA reagent | RNAi control (empty vector) |
Addgene | RRID:Addgene_1654 | Vector: L4440 Host Strain: HT115 (DE3) |
| recombinant DNA reagent | RNAi clone (nsun-1) | Source Bioscience | Cat# CUUkp3301A161Q | Vector: L4440 Host Strain: HT115 (DE3) |
| recombinant DNA reagent | RNAi clone (nsun-5) |
Schosserer et al., 2015
PMID:25635753 |
Vector: L4440 Host Strain: HT115 (DE3) |
|
| sequence-based reagent | PCR primers | This paper | See Supplementary file 1 | |
| sequence-based reagent | LD2648 (ITS1) | Bar et al., 2016 PMID:27457958 | Northern blot probe, sequence: CACTCAACTGACCGTGAAGCCAGTCG | |
| sequence-based reagent | LD2649 (ITS2) | Bar et al., 2016 PMID:27457958 | Northern blot probe, sequence: GGACAAGATCAGTATGCCGAGACGCG | |
| commercial assay or kit | Direct-zol RNA Miniprep | Zymo Research | Cat# R2051 | |
| commercial assay or kit | EZ RNA Methylation Kit | Zymo Research | Cat# R5001 | |
| commercial assay or kit | ExACT Genotyping Kit | BioCat | Cat# 2212–500-BL | |
| commercial assay or kit | High-Capacity cDNA Reverse Transcription Kit | Life Technologies | Cat# 4368814 | |
| commercial assay or kit | 5x HOT FIREPol EvaGreen qPCR Mix | Medibena | Cat# SB_08–24-GP | |
| chemical compound, drug | 5-Fluoro-2′-deoxyuridine (FUdR) | Sigma Aldrich | Cat# F0503-100MG | |
| chemical compound, drug | Puromycin | Invivogen | Cat# ant-pr-1 | |
| chemical compound, drug | TRIzol LS Reagent | Life Technologies | Cat# 10296028 | |
| software, algorithm | Image J | Image J | Fiji, RRID:SCR_002285 | Version 2.0.0-rc-65/1.51 w; Java 1.8.0_162 [64-bit] |
| software, algorithm | WormLab | MBF Bioscience | Version 4.1.1 | |
| software, algorithm | R | The R Foundation for Statistical Computing | Version 4.0.3 Script for RNA-seq analysis: Source code 1 |
|
| software, algorithm | SigmaPlot | Systat Software Inc | Version 14 | |
| software, algorithm | Prism | GraphPad | Version 9.0.0 | |
| software, algorithm | Galaxy | Galaxy Project | RRID:SCR_006281 |
https://usegalaxy.org/
Version numbers of individual tools are indicated in Materials and methods |