Skip to main content
. 2020 Dec 18;9:e54491. doi: 10.7554/eLife.54491

Key resources table.

Reagent type
(species) or
resource
Designation Source or
reference
Identifiers Additional
information
Antibody Rabbit polyclonal anti-5-HT MilliporeSigma Cat# S5545; RRID:AB_477522 (1:1000)
Antibody Chicken polyclonal anti-GFP Aves Laboratory Cat# GFP-1020, RRID:AB_10000240 (1:1000)
Antibody Rabbit polyclonal anti-DsRed Takara Bio Cat# 632496, RRID:AB_10013483 (1:1000)
Antibody Rabbit polyclonal anti-tagRFP Evrogen Cat# AB233, RRID:AB_2571743 (1:200)
Antibody Goat polyclonal anti-Chicken IgY (H+L) Secondary Antibody, Alexa Fluor 488 ThermoFisher Sci. Cat# A-11039;
RRID:AB_2534096
(1:500)
Antibody Goat polyclonal anti-Rabbit IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 568 ThermoFisher Sci. Cat# A-11011;
RRID:AB_143157
(1:500)
Antibody Goat polyclonal anti-Rat IgG (H+L) Cross-Adsorbed Secondary Antibody, Alexa Fluor 488 ThermoFisher Sci. Cat# A-11006, RRID:AB_2534074 (1:500)
Chemical compound, drug Metronidazole MP Biomedicals Cat# 0215571080
Strain, strain background (Danio rerio) npvf ct845 mutant Lee et al., 2017 RRID:ZDB-ALT-170927-1
Strain, strain background (Danio rerio) tph2 ct817 mutant Chen et al., 2013a RRID:ZDB-ALT-131122-14
Strain, strain background (Danio rerio) Tg(npvf:eGFP) ct847Tg Lee et al., 2017 RRID:ZDB-ALT-170927-3
Strain, strain background (Danio rerio) Tg(npvf:GCaMP6s-P2A-tdTomato) ct872Tg Lee et al., 2019 ZFIN: ZDB-ALT-190725–5
Strain, strain background (Danio rerio) Tg(npvf:ReaChR-mCitrine) ct849Tg Lee et al., 2017 RRID:ZDB-ALT-170927-5
Strain, strain background (Danio rerio) Tg(npvf:kalta4) ct848Tg Lee et al., 2017 RRID:ZDB-ALT-170927-4
Strain, strain background (Danio rerio) Zebrafish: Tg(tph2:eNTR-mYFP) ct866Tg Oikonomou et al., 2019 RRID:ZDB-ALT-190508-3
Strain, strain background (Danio rerio) Tg(tph2:GCaMP6s-P2A-NLS:tdTomato) ct874 This study; Figure 2 and Figure 2—figure supplements 3 and 4. ZFIN: ZDB-ALT-200512–2 GCaMP6s-P2A-NLS:tdTomato expressed under the tph2 promoter; – Prober Lab
Strain, strain background (Danio rerio) Tg(UAS:nfsb-mCherry) rw0144Tg Agetsuma et al., 2010 RRID:ZDB-ALT-110215-7
Strain, strain background (Danio rerio) Tg(UAS:TRPV1-tagRFP-T) ct851Tg Lee et al., 2017 RRID:ZDB-ALT-170927-7
Sequence-based reagent Primer: tph2 mutant genotyping primer 1: AGAACTTACAAAACTCTATCCAACTC Oikonomou et al., 2019
Sequence-based reagent Primer: tph2 mutant genotyping primer 2: AGAGAGGACAACATCTGGGG Oikonomou et al., 2019
Sequence-based reagent Primer: tph2 mutant genotyping primer 3: TAATCATGCAGTCCGTTAATACTC Oikonomou et al., 2019
Sequence-based reagent Primer: npvf mutant genotyping primer 1: CAGTGGTGGTGCGAGTTCT Lee et al., 2017
Sequence-based reagent Primer: npvf mutant genotyping primer 2: GCTGAGGGAGGTTGATGGTA Lee et al., 2017
Sequence-based reagent Primer: Tg(npvf:ReaChR-mCitrine) genotyping primer 1: CACGAGAGAATGCTGTTCCA Lee et al., 2017
Sequence-based reagent Primer: Tg(npvf:ReaChR-mCitrine) genotyping primer 2: CCATGGTGCGTTTGCTATAA Lee et al., 2017
Sequence-based reagent Primer: Tg(UAS:TRPV1-tagRFP-T) genotyping primer 1: CAGCCTCACTTTGAGCTCCT: Lee et al., 2017
Sequence-based reagent Primer: Tg(UAS:TRPV1-tagRFP-T) genotyping primer 2: TCCTCATAAGGGCAGTCCAG Lee et al., 2017
Software, algorithm MATLAB R2017b Mathworks RRID:SCR_001622
Software, algorithm Prism6 GraphPad RRID:SCR_002798
Software, algorithm Image J/Fiji Schneider et al., 2012 RRID:SCR_002285
Other 96-well plate GE Healthcare Life Sciences Cat#: 7701–1651
Other MicroAmp Optical Adhesive Film Thermo Fisher Scientific Cat#: 4311971