Abstract
The present paper aims to determine the frequency and antibiotic resistance patterns of pathogenic bacteria, the virulence factor profile of Escherichia coli and mannose-binding lectin (MBL) gene polymorphism in individuals with diabetes mellitus (DM) and urinary tract infection (UTI). The population under study was 130 individuals with type 2 diabetes mellitus (T2DM) and UTI. The patients' clinical characteristics and urine and blood samples (5 mL) were collected. Antibiotic resistance was determined using a disc diffusion method, and the results were interpreted according to CLSI. The presence of virulence genes was detected by multiplex PCR. To detect the MBL gene polymorphism, PCR and restriction fragment length polymorphism methods were applied. The predominant Gram-negative and Gram-positive bacteria included E. coli and Streptococcus spp.viridans group, respectively. Women were more susceptible to the incidence of UTI than men. The E. coli isolates showed a high level of resistance to amoxicillin-clavulanic acid (87.35%), and nitrofurantoin and ceftizoxime were the most effective antimicrobial agents for E. coli. Cefotaxime and ceftizoxime were the most effective antimicrobial agents for Enterobacter spp., norfloxacin and ciprofloxacin were the most effective antimicrobial agents for Staphylococcus epidermidis and Staphylococcus saprophyticus. papGII (52.87%) and papEF (1.14%) had the highest and lowest frequency among examined genes in E. coli isolates, respectively. The GG genotype had the highest frequency among patients with T2DM and UTI. Results showed that the detection of E. coli in individuals with an AA genotype, codon 54 of the MBL gene, can play an important role in the molecular diagnosis and timely treatment of bacterial infections in individuals with diabetes.
Keywords: Antibiotic resistance, diabetes, Escherichia coli, mannose-binding lectin gene, urinary tract infections
Introduction
Diabetes mellitus (DM) as a chronic and metabolic disorder is associated with high levels of blood glucose and reduced insulin production and is considered a global challenge for health-care specialists [1,2]. Type 2 diabetes mellitus (T2DM) is a heterogeneous class of disease, and >90% of individuals with DM have T2DM [3]. T2DM occurs as a result of deficient insulin action and inadequate insulin secretion rather than insufficient use of insulin. Individuals with T2DM are at high risk of moderate or severe infections, including gangrenous cholecystitis, foot infections, soft-tissue infections and urinary tract infections (UTI) [1,4,5]. As the result of persistent neurological bladder dysfunction and urine glucose excretion, UTI are the most prevalent bacterial infection detected in individuals with DM [6]. In comparison with individuals without DM, the risk of a UTI is three-to four-fold higher in individuals with DM [7]. Different spectra of severe complications of UTI in individuals with T2DM range from asymptomatic bacteriuria, cystitis, emphysematous cystitis, pyelonephritis, renal papillary necrosis, renal abscesses, to severe urosepsis [5]. Moreover, UTI are associated with end-stage renal disease or impaired renal function among paediatric patients, leading to several abnormalities in patients with increased risk of pyelonephritis, increased premature delivery and high fetal mortality among pregnant women [[8], [9], [10]]. In general, DM can increase the level of urine glucose and pH, so the urine becomes an appropriate microenvironment for harmful bacteria to grow and reproduce [11]. Individuals with DM are more susceptible to resistant bacterial pathogens due to their complicated UTI, including vancomycin-resistant enterococci, fluoroquinolone-resistant uropathogens, extended-spectrum β-lactamase-positive Enterobacteriaceae and carbapenem-resistant Enterobacteriaceae [5]. Among different pathogenic bacteria, Escherichia coli, Klebsiella spp., Staphylococcus aureus, Staphylococcus saprophyticus, Enterococcus faecalis, Proteus mirabilis, Pseudomonas aeruginosa, Group B streptococci and Candida species are frequently isolated from individuals with DM with UTI [4,12,13]. However, in DM and non-DM patients, E. coli is the pathogen most conducive to UTI [6]. Escherichia coli causes severe infections in individuals with any underlying condition such as DM. According to the results of studies in Japanese and Indian patients with UTI in 2014, the isolation rates of E. coli were 26% and 55.1%, respectively [14,15]. However, among European patients with UTI, isolation of this bacterium has fallen over the past 15 years [16,17]. Moreover, most uropathogens such as E. coli isolated from individuals with DM are resistant to several classes of antibiotics. Hence, choosing appropriate antibiotics probably decreases and prevents bacterial resistance [17]. The results of several published studies revealed that individuals with DM were susceptible to the vital risk factor in the multidrug-resistant property of uropathogens [4,18]. On the one hand, the number of studies evaluating the antibiotic resistance in individuals with DM is limited. On the other hand, the frequency of virulence markers in these bacteria is high; E. coli is characterized by several virulence factors, including iron acquisition/transport system, adhesive organelles, flagella and haemolysin, to survive in and successfully colonize the urinary tract [19,20]. Data concerning the frequency of different pathogens in UTI among individuals with DM, the frequency of virulence markers and antibiotic resistance profiles of E. coli isolates are helpful for physicians and health-care professionals to treat the infection. Individuals with T2DM are prone to E. coli infections. Resistance to the antibiotics used in treating these infections can cause many problems. However, the presence of virulence factors is also involved in colonization and disease severity, and the polymorphism of mannose-binding lectin (MBL), which is an important component of innate immunity, may play a role in the susceptibility and diagnosis of E. coli. The present study aims to determine the frequency of pathogenic bacteria that cause UTI; identify their antibiotic resistance profile; determine the frequency of virulence markers in E. coli isolates and determine MBL gene polymorphism and its association with DM and UTI.
Materials and methods
Study population, clinical samples and bacterial identification
A total of 130 individuals with T2DM and UTI referred to Hakim laboratory in Tehran, Iran between January 2018 and December 2019 cooperated in this retrospective study. The average age of the study population was 45 years. The exclusion criteria for patient selection include recent hospitalization history, patients with urinary catheters, immunocompromised patients and use of antibiotics over the last 14 days. All individuals with DM with a UTI and positive urine cultures were included in this study. Patients with T2DM were selected in line with the standard definition of the American Diabetes Association. Overall, 130 urine and blood samples (5 mL) were collected from the selected patients. The positive urine samples were subcultured on specific media (all media from Merck, Darmstadt, Germany), namely eosin methylene blue agar, blood agar plates, MacConkey agar and mannitol salt agar; then, Gram-staining of bacterial colonies was performed. The isolation and identification of different bacterial strains of positive cultures were performed using conventional biochemical tests such as IMVIC test (indole, methyl red, Voges Proskauer, and citrate), urease test, catalase and oxidase tests, coagulase test, CAMP test (Christie-Atkins-Munch-Peterson), growth on Kligler iron agar, SIM (sulphide indole motility), bile esculin agar, growth on 6% NaCl and DNase test.
Antibiotic susceptibility test
The susceptibility of the isolated pathogens was determined using the Kirby–Bauer disc diffusion method on Mueller–Hinton agar (Merck) and the vancomycin susceptibility test was carried out by a microdilution method for staphylococci. The following antibiotics are considered in the study: trimethoprim-sulfamethoxazole, nalidixic acid, nitrofurantoin, norfloxacin, ciprofloxacin, amoxicillin-clavulanic acid, ceftizoxime, gentamicin, cefixime, ceftazidime, ceftriaxone, vancomycin and cefotaxime. The antibiotic discs were purchased from MAST company (Merseyside, United Kingdom). CLSI criteria were considered in interpreting the results. Bacterial isolates, including Pseudomonas aeruginosa (ATCC 27853), Staphylococcus aureus ATCC 25923 and E. coli (ATCC 25922), were used as quality control strains.
DNA extraction and multiplex PCR
Genomic DNA was extracted from E. coli strains cultured in brain–heart infusion medium using the DNA extraction kit (GeNet Bio Company, Daejeon, Korea; Cat. no. K-3000) according to the manufacturer's instructions and, then, preserved at –80°C. Multiplex PCR was conducted for papA, papC, papEF, papGI, papGII and papGIII genes using specific primer pairs, followed by DNA sequencing [21]. The primers used in this study are listed in Table 1. Multiplex PCR was conducted in a final volume of 25 μL reaction mixture containing 12 μL of 2 × Master Mix (Cinnagene, Tehran, Iran; Cat. no. PR901638) including 0.4 mmol/L dNTPs, 1 × PCR buffer, 0.08 IU Taq DNA polymerase and 3 mmol/L MgCl2, 0.5 μM of each primer (10 mM), 3 μL of template DNA and 9 μL of sterile distilled water. The multiplex PCR were performed in the following conditions: one cycle at 94°C for 4 minutes, followed by 35 cycles at 94°C for 1 minute, 55°C for 1 minute and 72°C for 2 minutes with a final extension at 72°C for 10 minutes following the last cycle. Escherichia coli ATCC 25922 and distilled water were used as positive and negative controls, respectively. Finally, the PCR products were screened on a 2% agarose gel stained with DNA safe stain (Sinaclon), then visualized and photographed under UV light.
Table 1.
Primers used for the detection of the virulence markers and the MBL gene
| Primers name | Sequence (5'→3′) | PCR product size (bp) | |
|---|---|---|---|
| papA | F | ATGGCAGTGGTGTTTTGGTG | 720 |
| R | CGTCCCACCATACGTGCTCTTC | ||
| papC | F | GTGGCAGTATGAGTAATGACCGTTA | 200 |
| R | ATATCCTTTCTGCAGGGATGCAATA | ||
| papEF | F | GCAACAGCAACGCTGGTTGCATCAT | 336 |
| R | AGAGAGAGCCACTCTTATACGGACA | ||
| papGI | F | TCGTGCTCAGGTCCGGAATTT | 461 |
| R | TGGCATCCCCCAACATTATCG | ||
| papGII | F | GGGATGAGCGGGCCTTTGAT | 190 |
| R | CGGGCCCCCAAGTAACTCG | ||
| papGIII | F | GGCCTGCAATGGATTTACCTGG | 258 |
| R | CCACCAAATGACCATGCCAGAC | ||
| MBL 54 | F | GAGGCTTAGACCTATGGGGCTAG | 329 |
| R | CCCCTTTTCTCCCTTGGTGT | ||
DNA extraction from serum samples and PCR
DNA was extracted from serum samples using the DNA extraction kit (High Pure PCR Template Preparation Kit; Roche, Mannheim, Germany, Cat. no. 11769828001) according to the manufacturer's guidelines. The primer sequence used for the MBL gene is shown in Table 1 [22]. The PCR was performed in a 25-μL reaction mixture containing 11 μL of 1 × Master Mix (Cinnagene, Tehran, Iran; Cat. no. PR901638) that includes 0.4 mmol/L dNTPs, 1 × PCR buffer, 0.08 IU Taq DNA polymerase and 3 mmol/L MgCl2, 2 μL of each primer (10 mM), and 4 μL of template DNA and 6 μL of sterile distilled water. The PCR was performed in the following conditions: one cycle at 95°C for 10 minutes, followed by 35 cycles at 95°C for 30 seconds, 55°C for 40 seconds and 74°C for 1 minute with a final extension at 74°C for 10 minutes following the last cycle.
Determining the MBL gene polymorphism by RFLP
To identify the MBL gene polymorphism, the restriction fragment length polymorphism (RFLP) method with a specific enzyme was implemented. Briefly, a 20-μL RFLP mixture consists of 2 μL of 10 × BanI restriction enzyme buffer, 0.5 μl BanI restriction enzyme (5 units), 10 μL PCR product (0.1–0.5 μg) and 7.5 μL sterile distilled water. In the next step, the RFLP mixture was vortexed and incubated at 37°C for 3 hours. Moreover, to prevent the enzymatic reaction, microtubes were incubated at 65°C for 20 minutes. Finally, PCR products were screened on 2.5% agarose gel, stained with DNA-safe stain (Sinaclon), and visualized on a UV transilluminator.
Statistical analysis
The patient information was added to the statistical package SPSS v.23.0 (SPSS Inc., Chicago, IL, USA) and analysed using χ2 test.
Results
Clinical features, serum findings and pathogen distribution
A total of 130 individuals with T2DM and UTI cooperated in this study, and the results showed that women were more susceptible to the incidence of UTI than men. In this study, 89% of patients were female and 11% were male (sex ratio 12%, p <0.001). The incidence of uropathogens in individuals with DM is shown in Table 2. Gram-negative and Gram-positive bacteria comprised 86.1% (n = 112) and 13.9% (n = 18) of the total bacteria, respectively. The isolated Gram-negative bacteria included E. coli (87/112; 77.6%), Enterobacter spp. (17/112; 15.1%), Citrobacter spp. (2/112; 1.7%), Acinetobacter spp. (2/112; 1.7%), Klebsiella spp. (2/112; 1.7%), Proteus spp. (1/112; 0.9%) and Pseudomonas aeruginosa (1/112; 0.9%), respectively. Furthermore, the most predominant isolated Gram-positive bacteria included Streptococcus spp. viridans group (6/18; 33.3%), Staphylococcus epidermidis (4/18; 22.2%), Staphylococcus saprophyticus (4/18; 22.2%) and Enterococcus spp. (3/18; 16.6%).
Table 2.
The incidence of the uropathogens in diabetic patients
| Pathogens | Men, n/N (%) | Women, n/N (%) | Patients, n/N (%) |
|---|---|---|---|
| Escherichia coli | 8/130 (6.1) | 79/130 (60.7) | 87/130 (66.9) |
| Enterobacter spp. | 2/130 (1.5) | 15/130 (11.5) | 17/130 (13) |
| Streptococcus spp.viridans group | 1/130 (0.7) | 5/130 (3.8) | 6/130 (4.6) |
| Haemolytic streptococcus | 0/130 (0) | 1/130 (0.7) | 1/130 (0.7) |
| Staphylococcus epidermidis | 0/130 (0) | 4/130 (3) | 4/130 (3) |
| Staphylococcus saprophyticus | 1/130 (0.7) | 3/130 (2.3) | 4/130 (3) |
| Citrobacter spp. | 0/130 (0) | 2/130 (1.5) | 2/130 (1.5) |
| Acinetobacter spp. | 1/130 (0.7) | 1/130 (0.7) | 2/130 (1.5) |
| Enterococcus spp. | 1/130 (0.7) | 2/130 (1.5) | 3/130 (2.3) |
| Klebsiella spp. | 0/130 (0) | 2/130 (1.5) | 2/130 (1.5) |
| Proteus spp. | 0/130 (0) | 1/130 (0.7) | 1/130 (0.7) |
| Pseudomonas spp. | 0/130 (0) | 1/130 (0.7) | 1/130 (0.7) |
| Total | 14/130 (10.7) | 116/130 (89.2) | 130/130 (100) |
Antimicrobial susceptibility profile
The resistance rates of the isolated Gram-negative bacteria to the commonly used antimicrobials are shown in Table 3. Escherichia coli, as the most conducive pathogen of UTI, showed a high level of resistance to amoxicillin-clavulanic acid (87.35%), trimethoprim-sulfamethoxazole (55.17%) and nalidixic acid (55.17%), respectively. In addition, E. coli was found to have low levels of resistance to nitrofurantoin (2.29%) and ceftizoxime (19.54%), respectively. Cefotaxime (0%) and ceftizoxime (11.76%) were the most effective antimicrobial agents for Enterobacter spp. However, the resistance level to trimethoprim-sulfamethoxazole (47.05%) was high. Klebsiella spp. (100%) showed a high level of resistance to amoxicillin-clavulanic acid. Norfloxacin, ciprofloxacin, gentamicin and cefotaxime were the most effective antimicrobial agents for Klebsiella spp. Acinetobacter spp. showed a high level of resistance to ciprofloxacin and gentamicin (50%). Overall, among Gram-positive bacteria, Enterococcus spp. was 66.66% resistant to norfloxacin and gentamicin (high-level 120 μg). Moreover, norfloxacin (0% and 0%) and ciprofloxacin (0% and 0%) were the most effective antimicrobial agents for Staphylococcus epidermidis and Staphylococcus saprophyticus, respectively. On the whole, vancomycin was found to be an effective antibiotic against Gram-positive bacteria and exhibited a low level of resistance. A vancomycin susceptibility test was performed using the microdilution method for staphylococci. The resistance rates of the isolated Gram-positive bacteria to the commonly used antimicrobials are shown in Table 4.
Table 3.
Antimicrobial resistance of isolated Gram-negative bacteria in diabetic patients
| Antibiotics | Isolated bacteria |
|||||||
|---|---|---|---|---|---|---|---|---|
| Escherichia coli (n = 87) | Enterobacter spp. (n = 17) | Citrobacter spp. (n = 2) | Acinetobacter spp. (n = 2) | Klebsiella spp. (n = 2) | Proteus spp. (n = 1) | Pseudomonas aeruginosa (n = 1) | ||
| SXT | R (%) | 55.17 | 47.05 | 0 | 0 | 50 | 0 | – |
| NA | R (%) | 55.17 | 35.29 | 0 | – | 0 | 0 | – |
| NI | R (%) | 2.29 | 29.41 | 50 | – | 50 | – | – |
| NOR | R (%) | 35.63 | 23.52 | 0 | – | 0 | 0 | 0 |
| CIP | R (%) | 36.78 | 23.52 | 0 | 50 | 0 | 0 | 0 |
| AUG | R (%) | 87.35 | –a | – | – | 100 | 100 | – |
| ZOX | R (%) | 19.54 | 11.76 | 0 | – | 0 | 0 | – |
| GM | R (%) | 31.03 | 17.64 | 0 | 50 | 0 | 0 | 0 |
| CFM | R (%) | 31.03 | 41.17 | 0 | – | 50 | 0 | – |
| CAZ | R (%) | 26.46 | 23.52 | 0 | 0 | 50 | 0 | 0 |
| CRO | R (%) | 26.46 | 17.64 | 0 | 0 | 50 | 0 | – |
| CTX | R (%) | 37.93 | 0 | 0 | 0 | 0 | 0 | – |
Abbreviations: AUG, amoxicillin-clavulanic acid; CAZ, ceftazidime; CFM, cefixime; CIP, ciprofloxacin; CRO, ceftriaxone; CTX, cefotaxime; GM, gentamicin; NA, nalidixic acid; NI, nitrofurantoin; NOR, norfloxacin; SXT, trimethoprim-sulfamethoxazole; ZOX, ceftizoxime.
This antibiotic was not used for this bacterium.
Table 4.
Antimicrobial resistance of isolated Gram-positive bacteria in diabetic patients
| Antibiotics | Isolated bacteria |
|||||
|---|---|---|---|---|---|---|
| Streptococcus spp.viridans group (n = 6) | Haemolytic streptococcus (n = 1) | Staphylococcus epidermidis (n = 4) | Staphylococcus saprophyticus (n = 4) | Enterococcus spp. (n = 3) | ||
| SXT | R (%) | –a | – | 50 | 25 | – |
| NI | R (%) | – | – | – | 0 | 33.33 |
| NOR | R (%) | – | – | 0 | 0 | 66.66 |
| CIP | R (%) | – | – | 0 | 0 | 66.66 |
| GM | R (%) | – | – | 25 | 25 | 66.66b |
| VA | R/NSc (%) | 16.66c | 0c | 25d | 25d | 0 |
Abbreviations: CIP, ciprofloxacin; GM, gentamicin; NI, nitrofurantoin; NOR, norfloxacin; SXT, trimethoprim-sulfamethoxazole; VA, vancomycin.
This antibiotic was not used for this bacterium.
High-level (120 μg) gentamicin.
NS, non-susceptible.
MIC test.
Frequency of adhesion genes and MBL gene polymorphisms
Multiplex PCR was performed on papA, papC, papEF, papGI, papGII and papGIII genes. The results of the multiplex PCR show that the frequencies of the examined genes in 87 E. coli isolates were as follows: papGIII, 51.72%; papGII, 52.87%; papGI, 20.68%; papEF, 1.14%; papC, 27.58% and papA, 12.64%. In this study, the conventional PCR and RFLP methods with BanI restriction enzyme for the detection of MBL codon 54 genetic polymorphism (AA, GA, GG genotypes) were applied. The product sizes of restriction enzyme BanI are as follows: AA genotypes, 329 bp; AG genotype, 329 bp, 245 bp and 84 bp; and GG genotype 84 bp and 245 bp.
The results indicate that the frequency of the examined genotypes is as follows: AA genotype, 12%; GA genotype, 20%; and GG genotype, 68%. In short, the GG genotype has the highest frequency among individuals with T2DM and UTI.
Discussion
In general, individuals with T2DM are more susceptible to UTI and their complications caused by uropathogens than the general population [6]. UTI are the most frequent bacterial infections around the globe [1]. Among pathogenic microorganisms, Enterobacteriaceae, especially E. coli and Klebsiella spp., are the most frequently isolated microorganisms in men and women with UTI [9]. The current study was carried out to determine the frequency of the pathogenic bacteria that cause UTI, antibiotic susceptibility profile of the isolated pathogens, virulence markers of E. coli as the predominant pathogen in UTI, and MBL gene polymorphism among patients with T2DM in Tehran, Iran. The results of the current study revealed that most of the UTI occurred as the result of Gram-negative bacteria. In the urinary tract, Gram-negative bacteria, especially E. coli, can bind to the glycoconjugate receptors of epithelial cells and initiate the infection [1]. However, in a study carried out in China in 2017, the frequency of E. coli was suggested to be the same in patients regardless of the presence or absence of DM [3]. Proteus spp. and Pseudomonas aeruginosa have lower frequencies among Gram-negative bacteria isolated from patients; this result is consistent with a study conducted in India [23]. In the present study, Streptococcus spp. viridans group and haemolytic streptococci had the highest and lowest frequencies among Gram-positive bacteria isolated from patients, respectively, which was not consistent with studies conducted in Pakistan and Nepal [1,24]. In general, several factors such as type specimen for detecting the pathogen, applied detection methods, and specimen size can affect the frequency of the isolated pathogens [25,26]. Among the different antibiotics tested against E. coli isolates, nitrofurantoin and ceftizoxime were the most effective antibiotics; this is consistent with the rates reported in Pakistan [1], India [27] and France [28]. These results show the restricted use of amoxicillin-clavulanic acid, trimethoprim-sulfamethoxazole, nalidixic acid, and use of nitrofurantoin and ceftizoxime for E. coli, at least in the study area. Escherichia coli showed a high level of resistance to amoxicillin-clavulanic acid, trimethoprim-sulfamethoxazole and nalidixic acid. This result is consistent with the results of a study conducted in Nepal in 2019 [29]. In studies on E. coli, which causes UTI in Iran, the highest resistance is related to ampicillin, amoxicillin and tetracycline. This indicates that the widespread use of commonly used antibiotics has led to resistance. However, these studies have shown that antibiotics such as imipenem, nitrofurantoin and amikacin are the most effective treatments. According to studies conducted in Iran, it is recommended not to use penicillin, first-generation cephalosporins and trimethoprim-sulfamethoxazole in primary E. coli infections [30].
Enterobacter spp. showed the lowest and highest rates of resistance to cefotaxime and trimethoprim-sulfamethoxazole, respectively. Based on the acquired information, appropriate antibiotic selection is required to facilitate the treatment of UTI caused by pathogenic bacteria. Consequently, primary knowledge about antibiotic resistance profiles in UTI caused by uropathogens can be of help when making a precise therapeutic choice [25]. Enterobacter is a causative agent of nosocomial infections, and these strains are often resistant to quinolones, third-generation cephalosporins and penicillins because of previous treatment. The use of fourth-generation cephalosporins and carbapenems is recommended for treatment. Aminoglycosides are also a good choice if carbapenems use is limited [31].
Among the tested antibiotics, the results of the present study revealed that vancomycin is an effective antibiotic against Enterococcus spp., Staphylococcus saprophyticus and Staphylococcus epidermidis, which is consistent with the rates reported in China [6]. A vancomycin susceptibility test was done using the microdilution method for staphylococci. In the present study, the presence of papGIII, papGII, papGI, papEF, papC and papA genes among E. coli was analysed with multiplex PCR assays. The results indicated that papGII and papGIII had the highest frequencies, whereas papEF had the lowest frequency among E. coli strains. This was not consistent with studies conducted in South Korea [21], Pakistan [32] and Egypt [33]. The presence of these genes in E. coli isolates possibly contributed to biofilm formation, which could support their persistence [34,35]. MBL is the main molecule of the innate immune system and an acute-phase serum protein in the family that identifies pathogenic bacteria by its carbohydrate recognition domain [36]. The results of conventional PCR and RFLP methods on MBL gene polymorphism revealed that, among different genotypes, the GG genotype showed the highest frequency among patients with T2DM and UTI.
In conclusion, the results of the present study revealed that E. coli was the main pathogen in patients with T2DM and UTI and, also, nitrofurantoin was an effective antibiotic against E. coli infection. In addition, the results showed that the detection of E. coli in individuals with the AA genotype, codon 54 of the MBL gene, could play an important role in the molecular diagnosis and timely treatment of bacterial infections in individuals with diabetes.
Author contribution
All authors made substantial contributions to the conception and design, acquisition of data, or analysis and interpretation of data. They played an active role in drafting the article or revising it critically to achieve important intellectual content, gave the final approval of the version to be published, and agreed to be accountable for all aspects of the work.
Conflict of interest
All of the authors declare that there are no commercial, personal, political nor any other potentially conflicting interests related to the submitted manuscript.
Funding
This research did not receive any specific grant from funding agencies in the public, commercial or not-for-profit sectors.
Acknowledgement
We would like to thank the Department of Microbiology, Karaj Branch, Islamic Azad University, Karaj, Iran for their kind cooperation.
References
- 1.Zubair K.U., Shah A.H., Fawwad A., Sabir R., Butt A. Frequency of urinary tract infection and antibiotic sensitivity of uropathogens in patients with diabetes. Pak J Med Sci. 2019;35:1664–1668. doi: 10.12669/pjms.35.6.115. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 2.Wang Y., Dilidaxi D., Wu Y., Sailike J., Sun X., Nabi X.H. Composite probiotics alleviate type 2 diabetes by regulating intestinal microbiota and inducing GLP-1 secretion in db/db mice. Biomed Pharmacother. 2020;125:109914. doi: 10.1016/j.biopha.2020.109914. [DOI] [PubMed] [Google Scholar]
- 3.Liu F., Ling Z., Xiao Y., Yang Q., Zheng L., Jiang P. Characterization of the urinary microbiota of elderly women and the effects of type 2 diabetes and urinary tract infections on the microbiota. Oncotarget. 2017;8:100678–100690. doi: 10.18632/oncotarget.21126. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 4.Chakraborty A., Shenoy S., Adhikari P., Saralaya V., Rao S. Is diabetes mellitus an important risk factor for the antibiotic resistance in extraintestinal pathogenic Escherichia coli? Indian J Pathol Microbiol. 2017;60:546–549. doi: 10.4103/IJPM.IJPM_261_16. [DOI] [PubMed] [Google Scholar]
- 5.Nitzan O., Elias M., Chazan B., Saliba W. Urinary tract infections in patients with type 2 diabetes mellitus: review of prevalence, diagnosis, and management. Diabetes Metab Syndr Obes. 2015;8:129–136. doi: 10.2147/DMSO.S51792. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 6.He K., Hu Y., Shi J.C., Zhu Y.Q., Mao X.M. Prevalence, risk factors and microorganisms of urinary tract infections in patients with type 2 diabetes mellitus: a retrospective study in China. Ther Clin Risk Manag. 2018;14:403–408. doi: 10.2147/TCRM.S147078. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 7.Dalal S., Nicolle L., Marrs C.F., Zhang L., Harding G., Foxman B. Long-term Escherichia coli asymptomatic bacteriuria among women with diabetes mellitus. Clin Infect Dis. 2009;49:491–497. doi: 10.1086/600883. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 8.Chiţă T., Timar B., Muntean D., Bădiţoiu L., Horhat F., Hogea E. Urinary tract infections in Romanian patients with diabetes: prevalence, etiology, and risk factors. Ther Clin Risk Manag. 2017;13:1–7. doi: 10.2147/TCRM.S123226. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 9.James R., Hijaz A. Lower urinary tract symptoms in women with diabetes mellitus: a current review. Curr Urol Rep. 2014;15:440. doi: 10.1007/s11934-014-0440-3. [DOI] [PubMed] [Google Scholar]
- 10.Banerjee M., Majumdar M., Kundu P.K., Maisnam I., Mukherjee A.K. Clinical profile of asymptomatic bacteriuria in type 2 diabetes mellitus: an Eastern India perspective. Indian J Endocrinol Metab. 2019;23:293–297. doi: 10.4103/ijem.IJEM_674_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 11.Wilke T., Boettger B., Berg B., Groth A., Mueller S., Botteman M. Epidemiology of urinary tract infections in type 2 diabetes mellitus patients: an analysis based on a large sample of 456 586 German T2DM patients. J Diabetes Complications. 2015;29:1015–1023. doi: 10.1016/j.jdiacomp.2015.08.021. [DOI] [PubMed] [Google Scholar]
- 12.Alrwithey F.A., Alahmadi A.E., Alshehri A.M., Abalhassan I.A., Alhamad F.M., Khedher Y.Z. Urinary tract infection in patients with diabetes mellitus. Egypt J Hosp Med. 2017;69:2133–2136. [Google Scholar]
- 13.Nasser A., Moradi M., Jazireian P., Safari H., Alizadeh-Sani M., Pourmand M.R. Staphylococcus aureus versus neutrophil: scrutiny of ancient combat. Microb Pathog. 2019;131:259–269. doi: 10.1016/j.micpath.2019.04.026. [DOI] [PubMed] [Google Scholar]
- 14.Kuzdan C., Soysal A., Culha G., Altinkanat G., Soyletir G., Bakir M. Three-year study of health care-associated infections in a Turkish pediatric ward. J Infect Dev Ctries. 2014;8:1415–1420. doi: 10.3855/jidc.3931. [DOI] [PubMed] [Google Scholar]
- 15.Gupta S., Kapur S., Padmavathi D.V. Comparative prevalence of antimicrobial resistance in community-acquired urinary tract infection cases from representative States of northern and southern India. J Clin Diagn Res. 2014;8:DC09–DC12. doi: 10.7860/JCDR/2014/9349.4889. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 16.Bonadio M., Meini M., Spitaleri P., Gigli C. Current microbiological and clinical aspects of urinary tract infections. Eur Urol. 2001;40:439–444. doi: 10.1159/000049813. [DOI] [PubMed] [Google Scholar]
- 17.Kahlmeter G., Poulsen H.O. Antimicrobial susceptibility of Escherichia coli from community-acquired urinary tract infections in Europe: the ECO·SENS study revisited. Int J Antimicrob Agents. 2012;39:45–51. doi: 10.1016/j.ijantimicag.2011.09.013. [DOI] [PubMed] [Google Scholar]
- 18.Hamdan H.Z., Kubbara E., Adam A.M., Hassan O.S., Suliman S.O., Adam I. Urinary tract infections and antimicrobial sensitivity among diabetic patients at Khartoum, Sudan. Ann Clin Microbiol Antimicrob. 2015;14:26. doi: 10.1186/s12941-015-0082-4. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 19.Harwalkar A., Gupta S., Rao A., Srinivasa H. Prevalence of virulence factors and phylogenetic characterization of uropathogenic Escherichia coli causing urinary tract infection in patients with and without diabetes mellitus. Trans R Soc Trop Med Hyg. 2015;109:769–774. doi: 10.1093/trstmh/trv086. [DOI] [PubMed] [Google Scholar]
- 20.Azimi T., Nasser A., Shariati A., Shiadeh S.M., Safari H., Alizade-Sani M. The possible role of pathogenic and non-pathogenic bacteria in initiation and exacerbation of celiac disease; a comprehensive review. Curr Pharm Biotechnol. 2020;21:452–466. doi: 10.2174/1389201021666191219160729. [DOI] [PubMed] [Google Scholar]
- 21.Yun K.W., Kim H.Y., Park H.K., Kim W., Lim I.S. Virulence factors of uropathogenic Escherichia coli of urinary tract infections and asymptomatic bacteriuria in children. J Microbiol Immunol Infect. 2014;47:455–461. doi: 10.1016/j.jmii.2013.07.010. [DOI] [PubMed] [Google Scholar]
- 22.Bohlouli A., Ebrahimzadeh M.E., Kafil H.S., Asgharzadeh M. Evaluation mannose-binding lectin gene and promoter polymorphism in renal transplant recipients. J Pak Med Assoc. 2008;58:294–298. [PubMed] [Google Scholar]
- 23.Ramana B.V., Chaudhury A. Prevalence of uropathogens in diabetic patients and their resistance pattern at a tertiary care centre in south India. Int J Biol Med Res. 2012;3:1433–1435. [Google Scholar]
- 24.Acharya D., Bogati B., Shrestha G.T., Gyawali P. Diabetes mellitus and urinary tract infection: spectrum of uropathogens and their antibiotic sensitivity. Manmohan Mem Inst Health Sci. 2015;1:24–28. [Google Scholar]
- 25.Azimi T., Maham S., Fallah F., Azimi L., Gholinejad Z. Evaluating the antimicrobial resistance patterns among major bacterial pathogens isolated from clinical specimens taken from patients in Mofid Children’s Hospital, Tehran, Iran: 2013–2018. Infect Drug Resist. 2019;12:2089–2102. doi: 10.2147/IDR.S215329. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 26.Mokhtari H., Eslami G., Zandi H., Dehghan-Banadkouki A., Vakili M. Evaluating the frequency of aac (6′)-IIa, ant(2″)-I, intl1, and intl2 genes in aminoglycosides resistant Klebsiella pneumoniae isolates obtained from hospitalized patients in Yazd, Iran. Avicenna J Med Biotechnol. 2018;10:115–119. [PMC free article] [PubMed] [Google Scholar]
- 27.Bharti A., Chawla S.P., Kumar S., Kaur S., Soin D., Jindal N. Asymptomatic bacteriuria among the patients of type 2 diabetes mellitus. J Fam Med Prim Care. 2019;8:539–543. doi: 10.4103/jfmpc.jfmpc_403_18. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 28.Malmartel A., Ghasarossian C. Bacterial resistance in urinary tract infections in patients with diabetes matched with patients without diabetes. J Diabetes Complications. 2016;30:705–709. doi: 10.1016/j.jdiacomp.2016.01.005. [DOI] [PubMed] [Google Scholar]
- 29.Raya S., Belbase A., Dhakal L., Prajapati K.G., Baidya R., kishor Bimali N. In-vitro biofilm formation and antimicrobial resistance of Escherichia coli in diabetic and nondiabetic patients. Biomed Res Int. 2019:1474578. doi: 10.1155/2019/1474578. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 30.Mortazavi-Tabatabaei S.A., Ghaderkhani J., Nazari A., Sayehmiri K., Sayehmiri F., Pakzad I. Pattern of antibacterial resistance in urinary tract infections: a systematic review and meta-analysis. Int J Prev Med. 2019;10:169. doi: 10.4103/ijpvm.IJPVM_419_17. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 31.Davin-Regli A., Lavigne J.P., Pagès J.M. Enterobacter spp.: update on taxonomy, clinical aspects, and emerging antimicrobial resistance. Clin Microbiol Rev. 2019;32:e00002–e00019. doi: 10.1128/CMR.00002-19. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 32.Kumar N., Nahid F., Zahra R. Association of virulence factors, phylogenetic groups and antimicrobial resistance markers in Escherichia coli from Badin city, Pakistan. J Chemother. 2017;29(1):8–13. doi: 10.1080/1120009X.2016.1154682. [DOI] [PubMed] [Google Scholar]
- 33.Tharwat N., El-Sherif R., Elnagdy S., Marzaban R., Amer S. Virulent Escherichia coli strains among Egyptian patients with acute diarrhoea versus urinary tract infection, and their antibiotic susceptibility. Arab J Gastroenterol. 2019;20:74–80. doi: 10.1016/j.ajg.2019.01.003. [DOI] [PubMed] [Google Scholar]
- 34.Sharahi J.Y., Azimi T., Shariati A., Safari H., Tehrani M.K., Hashemi A. Advanced strategies for combating bacterial biofilms. J Cell Physiol. 2019;234:14689–14708. doi: 10.1002/jcp.28225. [DOI] [PubMed] [Google Scholar]
- 35.Novais Â., Vuotto C., Pires J., Montenegro C., Donelli G., Coque T.M. Diversity and biofilm-production ability among isolates of Escherichia coli phylogroup D belonging to ST69, ST393 and ST405 clonal groups. BMC Microbiol. 2013;13:144. doi: 10.1186/1471-2180-13-144. [DOI] [PMC free article] [PubMed] [Google Scholar]
- 36.Guo Y.L., Liu Y., Ban W.J., Sun Q., Shi G.L. Association of mannose-binding lectin gene polymorphisms with the development of pulmonary tuberculosis in China. BMC Infect Dis. 2017;17:210. doi: 10.1186/s12879-017-2310-3. [DOI] [PMC free article] [PubMed] [Google Scholar]