Skip to main content
. 2020 Sep 9;127(1):33–47. doi: 10.1093/aob/mcaa160

Table 2.

Comprehensive table of the most abundant micro- and minisatellites in the R. acetosa genome

Abundance on autosomes (%) Abundance on X (%) Abundance on Y (%) Monomer size (bp) Monomer sequence
0.0338 0.0188 0.3397 3 AAC
0.0000 0.0000 0.2988 9 AACACACCC
0.0087 0.0054 0.0049 3 AAG
0.0048 0.0033 0.0105 6 AACCCT
0.0046 0.0035 0.0087 9 AACAACAAG
0.0053 0.0040 0.0033 2 AG
0.0041 0.0030 0.0075 11 AAAAACGAGCG
0.0044 0.0023 0.0028 61 AAAAAATCGTCATCGAGCTC
AAAAACGTGTTTGATGACAT
TATTTCGAGCTTGATGACGTT
0.0000 0.0000 0.0232 10 AAACACACCC