Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Drosophila yakuba) | cav/anon:1G5 | GenBank | NCBI:XP_002099270 | |
| Gene (Drosophila melanogaster) | caravaggio/cav | Flybase | FLYBASE:FBgn0026257 | |
| Gene (Drosophila yakuba) | D. yakuba population genomic sample | NCBI | NCBI:PRJNA215876 | Rogers et al., 2015 |
| Genetic reagent (D. melanogaster) | HOAP[mel]-Flag; HOAP[mel] | This paper | ‘5Fmel’ in our library |
D. mel cav/HOAP + flag (in the native location) |
| Genetic reagent (D. melanogaster) | HOAP[yak]-Flag; HOAP[yak] | This paper | ‘25Fyak’ in our library | D. yak cav + flag (in the native location) |
| Genetic reagent (D. melanogaster) | HA-HipHop | This paper | ‘HA-HipHop[mel]−30 f’ in our library | D. mel HA-tagged hiphop (in the native location) |
| Genetic reagent (D. melanogaster) | cav[deletion]/TM6b | This paper | ‘8fdel/TM6b’ in our library | Complete deletion of cav gene region |
| Genetic reagent (D. melanogaster) | cav rescue transgene | This paper | ‘20123-attP40’ in our library | wildtype cav plus 5’ and 3’ flanking non-coding sequence (chr II) |
| Strain, strain background (D. melanogaster) | w[1118] | Bloomington Drosophila Stock Center | BDSC:5905 | |
| Strain, strain background (D. melanogaster) | w; Pin/CyO;Dr/TM6b | Edgar Lab via Malik Lab at FredHutch | w; Pin/CyO;Dr/TM6b | Source of Balancer chromosomes for crosses |
| Strain, strain background (D. melanogaster) | yw; hp1e/TM3 | Malik Lab | w; hp1e/TM3 | Source of TM3 balancer chromosome for crosses |
| Strain, strain background (D. melanogaster) | ca, cav[1]/TM6b | Bloomington Drosophila Stock Center | BDSC:64180 | Original caravaggio mutant (Cenci et al., 2003) |
| Strain, strain background (D. melanogaster) | yw;nos-Cas9(II-attP40) | Perrimon Lab via The BestGene, Inc | Injection stock for CRISPR experiments | |
| Strain, strain background (D. melanogaster) | y1w67c23;P{CaryP}attP40 | Perrimon Lab via The BestGene, Inc | Injection stock for rescue transgene | |
| Antibody | Anti-Flag (mouse monoclonal) | Sigma | Cat#: F3165 Clone M2 |
IF: (1:2500) WB: (1:10,000) |
| Antibody | Anti-HA (rat monoclonal) | Sigma | Cat#: ROAHAHA Clone 3F10 |
(1:2000) |
| Antibody | Anti-H3 (rabbit polyclonal) | Abcam | Cat# Ab1791 | (1:5000) |
| Antibody | Anti-H3K9me3 (rabbit polyclonal) | Abcam | Cat# ab8898 | (1:20) |
| Antibody | Anti-HP1 (rabbit polyclonal) | gift from Sally Elgin | MO552 | (1:100) |
| Antibody | Anti-Digoxigenin-AP, Fab fragments (sheep polyclonal) |
Sigma | Cat# 11093274910 | (1:250) |
| Antibody | Goat anti-rabbit IgG Alexa Fluor 568 (rabbit polyclonal) |
Thermo Fisher Scientific | Cat# A-11011 | (1:300) |
| Antibody | Goat anti-mouse IgG Alexa Fluor 488 (mouse polyclonal) |
Thermo Fisher Scientific | Cat# A21121 | (1:300) |
| Antibody | Donkey anti-sheep IgG Alexa Fluor 555 (sheep polyclonal) | Thermo Fisher Scientific | Cat# A-21436 | (1:500) |
| Other | Gold antifade reagent with DAPI | Thermo Fisher Scientific | Cat# P36931 | |
| Sequence-based reagent | HeTAprobeF | This paper | FISH probe primer | GGAACCCATCTTCAGAATTCCCTC |
| Sequence-based reagent | HeTAprobeR | This paper | FISH probe primer | GTGGATGCGGAACAGAATTT |
| Recombinant DNA reagent | 5’ guide RNA (cav) in pBFv-U6.2 | This paper | CAGATGGTCAAAGAGGTGCA | |
| Recombinant DNA reagent | 3’ guide RNA (cav) in pBFv-U6.2 | This paper | GCTATTGAGGTGACGTCGAT | |
| Recombinant DNA reagent | 5’ guide RNA (hiphop) in pBFv-U6.2 | This paper | GGTGCATGATCTATTCCAGA | |
| Recombinant DNA reagent | 3’ guide RNA (hiphop) in pBFv-U6.2 | This paper | TACTTGATGGGAACCACAGG | |
| Commercial assay or kit | PCR DIG Probe Synthesis Kit | Sigma | Cat# 11636090910 | |
| Commercial assay or kit | Kwikquant Western Blot detection kit | Kindle Biosciences | Cat# R1004 | |
| Commercial assay or kit | Qiagen RNeasy Kit | Qiagen | Cat# 74104 | |
| Commercial assay or kit | PureLink Genomic DNA kit | Thermo-Fisher Scientific | Cat# k1820-02 | |
| Commercial assay or kit | TruSeq Stranded Total RNA Library Prep | Illumina | Cat# 20020597 | |
| Commercial assay or kit | NEBNext Ultra DNA Library Prep Kit for Illumina | New England Biolabs | Cat# E7370L | |
| Software, algorithm | McDonald-Kreitman test | http://mkt.uab.es | ||
| Software, algorithm | STAR | Dobin et al., 2013 | ||
| Other | D. mel genome assembly from long reads | PMID:31653862 | NCBI:ASM340191v1 | Chakraborty et al., 2019 |
| Other | Wildtype vs. H3K9R mutant RNA-seq | PMID:27566777 | NCBI: PRJNA338389 | Chakraborty et al., 2019 |