Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Puumala orthohantavirus) | Glycoprotein precursor (GPC); used in recombinant Gc production | GenBank | CAB43026.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Puumala orthohantavirus) | Glycoprotein precursor (GPC); used in PUUV VLP production | GenBank | CCH22848.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Hantaan orthohantavirus) | Glycoprotein precursor (GPC) | GenBank | AIL25321.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Gene (Andes orthohantavirus) | Glycoprotein precursor (GPC) | GenBank | AAO86638.1 | Synthetic cDNA was produced by GeneArt, Life Technologies |
| Strain, strain background (Escherichia coli) | Subcloning Efficiency DH5α Competent Cells | Thermo Fisher Scientific | Cat#: 18265017 |
Competent cells |
| Cell line (Homo-sapiens) | Human embryonic kidney HEK 293T | ATCC | CRL-3216 | |
| Cell line (Homo-sapiens) | Human embryonic kidney HEK293F | Thermo Fisher Scientific | Cat#: R79007 |
|
| Biological sample (Myodes Glareolus, Mus musculus) | Bank vole-mouse heterohybridoma producing mAb P-4G2 | Lundkvist and Niklasson, 1992 | ||
| Biological sample (Indiana vesiculovirus) | VSV-ΔG RFP | Reynard and Volchkov, 2015 | ||
| Recombinant DNA reagent | pHLsec plasmid | Aricescu et al., 2006 | ||
| Recombinant DNA reagent | pHLsec-8H-SUMO-1D4 plasmid | Chang et al., 2015 | ||
| Recombinant DNA reagent | pgk-φC31/pCB92 plasmid |
Chen et al., 2011 | ||
| Recombinant DNA reagent | pURD plasmid | Zhao et al., 2014 | ||
| Recombinant DNA reagent | Tim1/pCAGGs plasmid | Watt et al., 2014 | ||
| Recombinant DNA reagent | pCAGGS plasmid | Niwa et al., 1991 | ||
| Recombinant DNA reagent | Mouse IgG1 plasmid | von Boehmer et al., 2016 | ||
| Recombinant DNA reagent | Mouse IgK plasmid | von Boehmer et al., 2016 | ||
| Recombinant DNA reagent | Fab P-4G2 light chain synthetic DNA fragment | This study | Synthetic cDNA was produced by GeneArt, Life Technologies | |
| Recombinant DNA reagent | Fab P-4G2 heavy chain synthetic DNA fragment | This study | Synthetic cDNA was produced by GeneArt, Life Technologies | |
| Sequence-based reagent | Mouse IgG sequencing primers | von Boehmer et al., 2016 | List of primer sequences is provided in the referenced study | |
| Sequence-based reagent | PUUV Gc ectodomain cloning primer, forward | This study | CGCACCGGTGAGACACAGAACCTGAACAGCGGC | |
| Sequence-based reagent | PUUV Gc ectodomain cloning primer, reverse | This study | GCGGTACCCTCGCCGGACTTGGTGAACC | |
| Sequence-based reagent | Fab P-4G2 HC R100A mutagenesis primer, forward | This study | GTATTACTGTACAAGAGATGCATTAGGCCCTTTTGA | |
| Sequence-based reagent | Fab P-4G2 HC R100A mutagenesis primer, reverse | This study | TCAAAAGGGCCTAATGCATCTCTTGTACAGTAATAC | |
| Commercial assay or kit | Phusion High-Fidelity PCR Master Mix with HF Buffer | New England Biolabs | Cat#: M0531S |
|
| Commercial assay or kit | SuperScript III reverse transcriptase | Thermo Fisher Scientific | Cat#: 18080093 |
|
| Commercial assay or kit | Quick Ligation kit | New England Biolabs | Cat#: M2200S |
|
| Chemical compound, drug | PEI Max 40K | Polysciences, Inc | Cat#: 24765–1 |
|
| Chemical compound, drug | PEI | Polysciences, Inc | Cat#: 23966–1 |
|
| Chemical compound, drug | Lipofectamine 2000 Transfection reagent | Thermo Fisher Scientific | Cat#: 11668027 |
|
| Chemical compound, drug | Kifunensine | Cayman Chemical | Cat#: 10009437 |
|
| Software, algorithm | XIA2 | Winter, 2010 | ||
| Software, algorithm | CCP4 | Potterton et al., 2003 | ||
| Software, algorithm | SWISS-MODEL | Waterhouse et al., 2018 | ||
| Software, algorithm | Coot | Emsley and Cowtan, 2004 | ||
| Software, algorithm | REFMAC | Murshudov et al., 1997 | ||
| Software, algorithm |
PHENIX | Adams et al., 2002 | ||
| Software, algorithm | Molprobity | Davis et al., 2007 | ||
| Software, algorithm | IMGT/V-QUEST server | Brochet et al., 2008 | ||
| Software, algorithm | GraphPad Prism | GraphPad Software, San Diego, CA, USA | ||
| Software, algorithm | PDBePISA server | Krissinel and Henrick, 2007 | ||
| Software, algorithm | PyMOL | The PyMOL Molecular Graphics System, Schrödinger, LLC | ||
| Software, algorithm | UCSF Chimera | Pettersen et al., 2004 | ||
| Software, algorithm | LigPlot+ software | Laskowski and Swindells, 2011 | ||
| Software, algorithm | Motioncor2 | Zheng et al., 2017 | ||
| Software, algorithm | CTFFIND4 | Rohou and Grigorieff, 2015 | ||
| Software, algorithm | tomo_preprocess script | This study | ||
| Software, algorithm | IMOD | Mastronarde and Held, 2017 | ||
| Software, algorithm | Dynamo | Castaño-Díez et al., 2012 | ||
| Software, algorithm | PatchFinder script | This study | ||
| Other | Chromatography column, Superdex 200 10/300 Increase | Cytiva | Cat#: 28990944 |
|
| Other | Chromatography column, HisTrap FF Crude 5 ml | Cytiva | Cat#: 17528601 |
|
| Other | 1-MDa cut-off dialysis membrane | Spectrum Chemical | ||
| Other | Holey carbon grids, 2 μm hole diameter | Protochips |