REAGENT or RESOURCE | SOURCE | IDENTIFIER |
---|---|---|
Antibodies and Lectins | ||
CALB1 rabbit (use 1:1,000). Labels distal tubules and collecting ducts | Sigma | Cat#C2724 |
CDH1 (E-Cadherin) mouse IgG2a (use 1:300). Labels distal tubules and collecting ducts | BD Biosciences | Cat#610181 |
CUBN rabbit IgG (use 1:500). Labels proximal tubules | Abcam | Cat#ab244274 |
EPCAM rabbit (use 1:100). Labels all tubular epithelia | Sigma | Cat#HPA026761 |
HNF1B rabbit (use 1:500). Labels nuclei of all tubular epithelia | Sigma | Cat#HPA002083 |
Lotus Tetragonolobus Lectin (LTL), Fluorescein (use 1:300). Labels proximal tubules | Vectorlabs | Cat#FL-1321 |
LRP2 (Megalin) mouse IgG1 (use 1:500). Labels proximal tubules | Novus Biologicals | Cat#NB110-96417 |
NPHS1 sheep IgG (use 1:200). Labels podocytes | R&D Systems | Cat#AF4269 |
SLC12A1 rabbit (use 1:1,000). Labels thick ascending limb | Sigma | Cat#HPA018107 |
WT1 mouse IgG1 (use 1:25). Labels podocyte nuclei | Santa Cruz Biotechnology | Cat#sc-7385 |
Hoechst 33258 (use 1:2,000/10 μM). Nuclear counterstain | Abcam | Cat#ab228550 |
Anti-rabbit-Dylight 488 (use 1:600) | Abcam | Cat#ab96899 |
Anti-mouse-Dylight 594 (use 1:600) | Abcam | Cat#ab96881 |
Anti-sheep-Alexa Fluor 594 (use 1:600) | Thermo Fisher | Cat#A11016 |
Chemicals, Peptides, and Recombinant Proteins | ||
1-Thioglycerol | Sigma | Cat#M6145 |
2-Mercaptoethanol | Thermo Fisher | Cat#21985023 |
Accutase | STEMCELL Technologies | Cat#7920 |
Agar | Sigma | Cat#A1296 |
AlbumiNZ™ protease reduced, immunoassay (EIA) grade, ≥97% (BSA used for immunohistochemistry) | MP Biomedicals | Cat#219989880 |
Chemically Defined Lipid Concentrate | Thermo Fisher | Cat#11905031 |
CHIR99021 | STEMCELL Technologies | Cat#72054 |
Dispase | STEMCELL Technologies | Cat#7923 |
DMEM, low glucose, pyruvate | Thermo Fisher | Cat#11885084 |
DPBS 1×, no calcium, no magnesium | Thermo Fisher | Cat#14190250 |
Ethanol absolute | Sigma | Cat#1.07017 |
Geltrex™ LDEV-Free Reduced Growth Factor Basement Membrane Matrix | Thermo Fisher | Cat#A1413202 |
Gentle Cell Dissociation Reagent | STEMCELL Technologies | Cat#7174 |
GlutaMAX Supplement | Thermo Fisher | Cat#35050061 |
Ham's F12 Nutrient Mix | Thermo Fisher | Cat#11765054 |
HEPES | Thermo Fisher | Cat#15630080 |
Horse serum | Sigma | Cat#H1270 |
HyAgarose™ LE Agarose | HydraGene | Cat#R9012LE |
Hydrochloric acid | Sigma | Cat#320331 |
IMDM | Thermo Fisher | Cat#12440053 |
Insulin-Transferrin-Selenium-Ethanolamine (ITS -X) | Thermo Fisher | Cat#51500056 |
K-252a (BDNF inhibitor) | Sigma | Cat#K1639 |
KnockOut™ Serum Replacement - Multi-Species | Thermo Fisher | Cat#A3181502 |
L-Ascorbic acid 2-phosphate sesquimagnesium salt hydrate | Sigma | Cat#A8960 |
Leica Surgipath Paraplast (Paraffin) | bio-strategy | Cat#LEIS39601006 |
Matrigel® Growth Factor Reduced Basement Membrane Matrix, LDEV-free | BD Biosciences | Cat#354230 |
MEM Non-Essential Amino Acids Solution | Thermo Fisher | Cat#11140050 |
mTeSR1 | STEMCELL Technologies | Cat#5850 |
Paraformaldehyde 8% | Emgrid Australia | Cat#157-8 |
Penicillin-Streptomycin | Thermo Fisher | Cat#15140122 |
PFHM-II Protein-Free Hybridoma Medium | Thermo Fisher | Cat#12040077 |
Plasmocin | InvivoGen | Cat#ant-mpt |
Poly(vinyl alcohol) | Sigma | Cat#P8136 |
Probumin® Bovine Serum Albumin | Sigma | Cat#821006 |
ProLong™ Diamond Antifade Mountant | Thermo Fisher | Cat#P36961 |
ROCK inhibitor Y-27632 | STEMCELL Technologies | Cat#72304 |
Sodium chloride | Sigma | Cat#71376 |
Trisodium citrate dihydrate | Sigma | Cat#W302600 |
StemFlex™ Medium | Thermo Fisher | Cat#A3349401 |
Sucrose | Sigma | Cat#S0389 |
TeSR™-E8™ | STEMCELL Technologies | Cat#05990 |
Tissue-Plus™ OCT Compound | Fisher Scientific | Cat#23-730-571 |
Triton X-100 | Sigma | Cat#X100 |
TRIzol™ Reagent | Thermo Fisher | Cat#15596026 |
Tween 20 | Sigma | Cat#P1379 |
UltraPure™ Tris Buffer | Thermo Fisher | Cat#15504020 |
Xylene | Sigma | Cat#534056 |
Other | ||
Cell lifter | Corning | Cat#3008 |
Corning tissue-culture treated culture dishes, D × H 100 mm × 20 mm | Merck Millipore | Cat#430167 |
Corning disposable spinner flasks | Sigma | Cat#CLS3152 |
Fisherbrand™ Multi Function 3D rotator | Fisher Scientific | Cat#15514080 |
Fisherbrand™ Histosette™ II Tissue Processing/Embedding Cassettes | Fisher Scientific | Cat#15-182-708A |
ImmEdge® Hydrophobic Barrier PAP Pen | Vector Labs | Cat#H-4000 |
LockMailer™ - Microscope Mailer and Staining Jar | Ted Pella | Cat#21096 |
Menzel™ Microscope Coverslips | Fisher Scientific | Cat#11778691 |
Nunc® CryoTubes® 1.8 mL, Internal thread | Sigma | Cat#V7634 |
pluriStrainer® 500 μm | Pluri Select | Cat#43-50500-03 |
Stericup-GP Sterile Vacuum Filtration System (500 mL) | Merck Millipore | Cat#S2GPU05RE |
Stericup-GP Sterile Vacuum Filtration System (200 mL) | Merck Millipore | Cat#SCGPU02RE |
Superfrost Plus Microscope Slides | Thermo Fisher | Cat#4951PLUS4 |
Tissue-Tek® Cryomold | VWR | Cat#4565 |
Ultra-Low Attachment 24-well plates | Merck Millipore | Cat#CLS3473 |
Ultra-Low Attachment 6-well plates | Merck Millipore | Cat#CLS3471 |
Oligonucleotides | ||
Primers for NPHS1 (marker for podocytes), fwd: AGTGTGGCTAAGGGATTACCC; rev: TCACCGTGAATGTTCTGTTCC | Przepiorski et al., 2018 | n/a |
Primers for LRP2 (marker for proximal tubule), fwd: AAATTGAGCACAGCACCTTTGA; rev: TCTGCTTTCCTGACTCGAATAATG | Przepiorski et al., 2018 | n/a |
Primers for SLC34A1 (marker for proximal tubule), fwd: CCATCATCGTCAGCATGGTCT; rev: GACAGCCAGTTAAAGCAGTCA | This paper | n/a |
Primers for SLC12A1 (marker for thick ascending limb), fwd: AGTGCCCAGTAATACCAATCGC; rev: GCCTAAAGCTGATTCTGAGTCTT | Przepiorski et al., 2018 | n/a |
Primers for UMOD (marker for thick ascending limb), fwd: CGGCGGCTACTACGTCTAC; rev: TGCCATCTGCCATTATTCGATTT | Przepiorski et al., 2018 | n/a |
Primers for SLC12A3 (marker for distal tubule), fwd: CCTGGGTGGAGACCTTCATTC; rev: GAGCCCCAATTTACCTCTGGC | This paper | n/a |
Primers for CDH1 (marker for distal tubule and collecting duct), fwd: ATTTTTCCCTCGACACCCGAT; rev: TCCCAGGCGTAGACCAAGA | Przepiorski et al., 2018 | n/a |
Primers for CALB1 (marker for distal tubule and collecting duct), fwd: TCCAGGGAATCAAAATGTGTGG; rev: GCACAGATCCTTCAGTAAAGCA | Przepiorski et al., 2018 | n/a |
Primers for GATA3 (marker for distal tubule and collecting duct), fwd: GCCCCTCATTAAGCCCAAG; rev: TTGTGGTGGTCTGACAGTTCG | Przepiorski et al., 2018 | n/a |
Primers for HPRT1 (reference housekeeping gene), fwd: CATTATGCTGAGGATTTGGAAAGG; rev: CTTGAGCACACAGAGGGCTACA | Przepiorski et al., 2018 | n/a |
Experimental Models: Cell Lines | ||
MAFB-P2A-eGFP H9 (ESC, female, labels podocytes) | Tran et al., 2019 | n/a |
HPSI0214i-wibj_2 (iPSC, female) | HipSci | n/a |
CRL1502 (clone C32) (iPSC, female) | n/a | RBK/GUDMAP Resources |
LRP2:mTagBFP2 (iPSC, male, labels proximal tubules) | Howden et al., 2018; Vanslambrouck et al., 2019 | RBK/GUDMAP Resources |
BJ RiPS (iPSC, male) | Warren et al., 2010; Przepiorski et al., 2018 | n/a |
MANZ-2-2 (iPSC, female) |
Przepiorski et al., 2018; Oh et al., 2020. |
n/a |
MANZ-4-37 (iPSC, male) |
Przepiorski et al., 2018; Oh et al., 2020. |
n/a |
HNF1B-/-, 3 clones (iPSC, female, isogenic to MANZ-2-2) | Przepiorski et al., 2018 | n/a |
CTNS-mutant lines, 3 clones (iPSC, male, patient-derived) | Hollywood et al., 2020 | n/a |
CTNS knockout lines, 3 clones (iPSC, female, isogenic to CRL1502 (clone C32)) | Hollywood et al., 2020 | n/a |