KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| InVivoMab anti-mouse PD-L1 (B7-H1) | BioXCell | Cat # BE0101; RRID:AB_10949073 |
| InVivoMab anti-mouse CSF1 | BioXCell | Cat # BE0204; RRID:AB_10950309 |
| InVivoMab rat IgG2a isotype control antibody | BioXCell | Cat # BE0089; RRID:AB_1107769 |
| Anti-mouse CD8a APC | Biolegend | Cat # 100712; RRID:AB_312751 |
| Anti-mouse CD8a PerCP/Cyanine5.5 | Biolegend | Cat # 100733; RRID:AB_2075239 |
| Anti-mouse CD4 APC | Biolegend | Cat # 100516; RRID:AB_312719 |
| Anti-mouse CD274(PD-L1) PE | Biolegend | Cat # 124307; RRID:AB_2073557 |
| Anti-mouse CD3 PE/Cy7 | Biolegend | Cat # 100220; RRID:AB_173205 |
| Anti-mouse CD11b PE | eBioscience | Cat # 12-0112-82; RRID:AB_2734869 |
| Anti-mouse CD11c FITC | Biolegend | Cat # 117306; RRID:AB_313775 |
| Anti-mouse CD11c APC/Cy7 | Biolegend | Cat # 117323; RRID:AB_830646 |
| Anti-mouse CD11c APC | Biolegend | Cat # 117310; RRID:AB_313779 |
| Anti-mouse F4/80 BV785 | Biolegend | Cat # 123141; RRID:AB_2563667 |
| Anti-mouse Gr-1 BV605 | Biolegend | Cat # 108441; RRID:AB_2562401 |
| Anti-mouse IFN-γ PerCP/Cyanine5.5 | eBioscience | Cat # 45-7311-82; RRID:AB_1107020 |
| Anti-mouse Granzyme B FITC | eBioscience | Cat # 11-8898-82; RRID:AB_10733414 |
| Anti-mouse Perforin PE | eBioscience | Cat # 12-9392-82; RRID:AB_466243 |
| Anti-mouse Ki67 BV421 | Biolegend | Cat # 151208; RRID:AB_2629748 |
| Anti-mouse CD80 FITC | Biolegend | Cat # 104706; RRID:AB_313127 |
| Anti-mouse CD86 PE | Biolegend | Cat # 105007; RRID:AB_313150 |
| Anti-mouse CD40 PE | eBioscience | Cat # MA5–17855; RRID:AB_2539239 |
| Anti-mouse OX40L PE | Biolegend | Cat # 108805; RRID:AB_313404 |
| Anti-mouse MHC II PE/Cy7 | Biolegend | Cat # 107630; RRID:AB_2069376 |
| Anti-mouse MHC II APC | Biolegend | Cat # 107614; RRID:AB_313329 |
| Anti-Mouse OVA257–264 (SIINFEKL) peptide bound to H-2Kb PE | Biolegend | Cat # 141603; RRID:AB_10897938 |
| Anti-mouse CD45 BV605 | Biolegend | Cat # 103139; RRID:AB_2562341 |
| Anti-mouse CD45 PerCP/Cyanine5.5 | Biolegend | Cat # 103132; RRID:AB_893340 |
| Anti-mouse Ly6C PerCP/Cyanine5.5 | Biolegend | Cat # 128012; RRID:AB_1659241 |
| Mouse SR-AI/MSR1 Affinity Purified Ab | R&D | Cat # AF1797; RRID:AB_2148246 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| BODIPY 493/503 | Invitrogen | Cat # D3922 |
| iTAg Tetramer/APC - H-2 Kb OVA (SIINFEKL) | MBL | Cat # TB-5001 −2 |
| Carbonyl cyanide 4-(trifluoromethoxy) phenylhydrazone (FCCP) | Sigma-Aldrich | Cat # C2920 |
| Bovine Serum Albumin, fatty acid free | Sigma-Aldrich | Cat # A8806 |
| Polybrene | Sigma-Aldrich | Cat # TR-1003 |
| Ovalbumin from Egg White | BBI | Cat # A003056–0100 |
| PHRODO GREEN STP ESTER | invitrogen | Cat # P35369 |
| HCS LIPIDTOX DEEP RED NEUTRAL LIPID STAIN | invitrogen | Cat # H34477 |
| PKH67 Green Fluorescent Cell Linker Midi Kit | Sigma | Cat # MIDI67–1KT |
| Collagenase IV | Life | Cat # 17104019–1 |
| CFSE | eBioscience | Cat # 65-0850-84 |
| CELL-TAK CELL TISSUE ADHESIVE | Biocoat | Cat # 354240 |
| Etomoxir sodium salt hydrate | Sigma | Cat # E1905–25MG |
| GW6471 | R&D | Cat #4618/50 |
| GW4869 | Selleck | Cat # S7609–5mg |
| Diphtheria Toxin | Merck Millipore | Cat # 322326–1MG |
| Triacsin C | Sigma | Cat # T4540–1MG |
| C75 | Sigma | Cat # C5490–5MG |
| PMA | Sigma | Cat # P1585–1MG |
| Ionomycin | Sigma | Cat # I3909–1ML |
| 5-tetradecyl-oxy-2-furoic acid | Sigma | Cat # T6575–25MG |
| Arachidonic acid | Sigma | Cat # A3611–10MG |
| Oleic acid | Sigma | Cat # O1008–1G |
| Palmitic acid | Sigma | Cat # 27734–1KG |
| Stearic acid | Merck Millipore | Cat # 569398–25MG |
| Recombinant Murine IL-2 | Peprotech | Cst # 212–12 |
| Recombinant Murine GM-CSF | Peprotech | Cat #315–03 |
| Recombinant Murine M-CSF | Peprotech | Cat #212–12 |
| Critical Commercial Assays | ||
| MojoSort Mouse CD8 T cell Isolation Kit | Biolegend | Cat # 480035 |
| MojoSort Mouse CD4 T cell Isolation Kit | Biolegend | Cat # 480005 |
| 10* Permeabilization buffer | eBioscience | Cat # 00-8333-56 |
| Fix/Permeabilization buffer set | eBioscience | Cat # 88-8824-00 |
| eBioscience Brefeldin A Solution (1000X) | eBioscience | Cat # 00-4506-51 |
| 10*RBC Lysis Buffer | eBioscience | Cat # 00-4300-54 |
| ExoAb Antibody Kit | SBI | Cat # EXOAB-KIT-1 |
| ExoQuick TC | SBI | Cat # EXOTC50A-1 |
| Lactate Colorimetric/Fluorometric Assay Kit | Biovision | Cat # 93-K607–100 |
| Mouse IFN-γ ELISA MAX Deluxe | Biolegend | Cat # 430805 |
| IFN-γ ELISPOT assay kit | BD | Cat # 552569 |
| Mouse TGF-beta 1 DuoSet ELISA | R&D | Cat # DY1679–05 |
| BCA Protein Assay Kit | Pierce | Cat # 23225 |
| Fast SYBR Green Master Mix | Applied Biosystems | Cat #4385612 |
| Seahorse XF24 Fluxpak mini | Agilent | Cat # 100867–100 |
| Experimental Models: Cell lines | ||
| DC2.4 lines | Laboratory of Mingzhao Zhu | N/A |
| TC1 lines | ATCC | Cat # JHU-1 |
| 4T1 lines | ATCC | Cat # CRL-2539 |
| B16/F10 lines | ATCC | Cat # CRL-6475 |
| MC38 lines | Laboratory of Yangxin Fu | N/A |
| MC38-OT I lines | Laboratory of Yangxin Fu | N/A |
| 293T lines | Laboratory of Guangxia Gao | N/A |
| Experimental Models: Organisms/Strains | ||
| C57BL/6 | Vital River Laboratory Animal Technology |
Cat #213 |
| BABL/c | Vital River Laboratory Animal Technology |
Cat #211 |
| C57BL/6-Tg (TcraTcrb)1100Mjb/J | The Jackson Laboratory | Cat # N000208 |
| PPARa Knockout mice | Cyagen Biosciences | Cat # KOCMP-21034-Ppara |
| GPF-Foxp3 mice | Laboratory of Yangxin Fu | N/A |
| CD11c-DTR mice | Laboratory of Yangxin Fu | N/A |
| Recombinant DNA | ||
| pCT-CD9-GFP (pCMV, Exosome/Secretory, CD9 Tetraspanin Tag) | SBI | Cat # CYTO122-PA-1 |
| psPAX2 | Addgene | Cat # Addgene plasmid#12260 |
| pMD2.G | Addgene | Cat # Addgene plasmid#12259 |
| Oligonucleotides | ||
| PPARα-F: AACATCGAGTGTCGAATATGTGG | This paper | N/A |
| PPARα-R: CCGAATAGTTCGCCGAAAGAA | This paper | N/A |
| 18S-F: CGGCTACCACATCCAAGGAA | This paper | N/A |
| 18S-R: GCTGGAATTACCGCGGCT | This paper | N/A |
| Deposited Data | ||
| RNA-Seq (generated) | This paper | GEO: GSE155881 |
| Software and Algorithms | ||
| GraphPad Prism 8 | Graphpad Software |
https://www.graphpad.com:443; RRID:SCR_002798 |
| FlowJo | BD |
https://www.flowjo.com/solutions/flowjo; RRID:SCR_008520 |
| R Project | R | http://www.r-project.org,; RRID:SCR_001905 |
| ImageJ | ImageJ public freeware |
https://imagej.nih.gov/nih-image/index.html; RRID:SCR 003073 |