Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (Escherichia coli) | Top10 | Thermo Fisher | Cat# C404003 | Chemically competent |
| Cell line (H. sapiens) | Hek293-EBNA1-6E | This paper | (RRID:CVCL_HF20) | Experimental results |
| Cell line (H. sapiens) | Hek293-EBNA1-6E ALG6-/- | This paper | Experimental results | |
| Cell line (H. sapiens) | Hek293-EBNA1-6E ALG6/UGGT1-/- | This paper | Experimental results | |
| Cell line (H. sapiens) |
Hek293-EBNA1-6E ALG6/UGGT2-/- | This paper | Experimental results | |
| Cell line (H. sapiens) | Hek293-EBNA1-6E ALG6/UGGT1/2-/- | This paper | Experimental results | |
| Cell line (H. sapiens) | Hek293-EBNA1-6E UGGT1-/- | This paper | Experimental results | |
| Cell line (H. sapiens) | Hek293-EBNA1-6E UGGT2-/- | This paper | Experimental results | |
| Cell line (H. sapiens) | Hek293-EBNA1-6E UGGT1/2-/- | This paper | Experimental results | |
| Antibody | IGF-1 receptor β (D23H3) (rabbit monoclonal) |
Cell Signaling | Cat # 9750 | WB (1:1000) IP (1:1000) |
| Antibody | IGF-IIR/CI-M6PR (D3V8C) (rabbit monoclonal) |
Cell Signaling | Cat# 14364 | WB (1:1000) |
| Antibody | β-hexosaminidase subunit β (EPR7978) (rabbit monoclonal) |
Abcam | Cat# (ab140649) | WB (1:500) |
| Antibody | BiP (C50B12) (rabbit monoclonal) |
Cell Signaling | Cat# 3177 | WB (1:1000) |
| Antibody | ENPP1 (N2C2) (rabbit polyclonal) |
Genetex | Cat# GTX103447 | WB (1:500) |
| Antibody | UGGT1 (rabbit polyclonal) |
Genetex | Cat# GTX66459 | WB (1:1000) |
| Antibody | Glyceraldehyde 3-Phosphate (mouse monoclonal) |
Millipore Sigma | Cat# (MAB374) | WB (1:1000) |
| Recombinant DNA reagent | pGEX-3X-GST-CRT (plasmid) | Baksh and Michalak, 1991 | Available from the Hebert lab upon request | |
| Recombinant DNA reagent | pGEX-3X-GST-CRT-Y109A (plasmid) | This paper | Available from the Hebert lab upon request | |
| Recombinant DNA reagent | gh260 | Narimatsu et al., 2018 | RRID:Addgene_106851 | gRNA for ALG6-/- |
| Recombinant DNA reagent | gh172 | Narimatsu et al., 2018 | RRID:Addgene_106833 | gRNA for UGGT1-/- |
| Recombinant DNA reagent | gh173 | Narimatsu et al., 2018 | RRID:Addgene_106834 | gRNA for UGGT2-/- |
| Recombinant DNA reagent | Cas9-GFP CAS9PBKS |
Lonowski et al., 2017 | RRID:Addgene_68371 | Cas9 for CRISPR-mediated knockout |
| Sequence-based reagent | CRT-Y109A_F | This paper | PCR primers | GGGGGCGGCGCCGTGAAGCT |
| Sequence-based reagent | CRT-Y109A_R | This paper | PCR primers | CCGGAAACAGCTTCACGTAGCCGC |
| Commercial assay or kit | TMT10plex, 0.8 mg | Thermo Fisher | Cat# 90110 | |
| Commercial assay or kit | TMT6plex, 0.8 mg | Thermo Fisher | Cat# 90061 | |
| Commercial assay or kit | BCA protein quantification kit | Pierce | Cat# 23227 | |
| Commercial assay or kit | C18 tips | Pierce | Cat # 87784 | |
| Commercial assay or kit | Quantitative colorimetric peptide assay | Pierce | Cat # 23275 |