Skip to main content
. 2020 Dec 22;9:e58037. doi: 10.7554/eLife.58037

Key resources table.

Reagent type (species) or resource Designation Source or reference Identifiers Additional information
Strain, strain background (Mus musculus, M/F) CD1 Charles River Crl:CD1(ICR)
Strain, strain background (Human herpesvirus 1) HSV Us11-GFP I gift from Ian Mohr, NYU. PMID:12915535
Strain, strain background (Human herpesvirus 1) HSV-1 17syn+ A gift from Roger Everett, MRC Virology Unit Glasgow
Cell line (Homo sapiens) 293LTV Cell Biolabs Cat # LTV-100
RRID:CVCL_JZ09
Cell line (Cercopithecus aethiops) Vero ATCC Cat # CCCL-81
RRID:CVCL_0059
Recombinant DNA reagent pCMV-VSV-G A gift from Bob Weinberg/Addgene PMID:12649500 Cat # 8454
RRID:Addgene_8454
Recombinant DNA reagent psPax2 A gift from Didier Trono/Addgene Cat # 12260
RRID:Addgene_12260
Antibody Anti-phospho-Akt (S473) (Rabbit monoclonal) Cell Signalling Technologies Cat # 4060
RRID:AB_2315049
WB (1:500)
Antibody Anti-Akt (pan) (Rabbit monoclonal) Cell Signalling Technologies Cat # C67E7
RRID:AB_915783
WB (1:1000)
Antibody Anti-phopsho-c-Jun (Rabbit monoclonal) Cell Signalling Technologies Cat # 3270
RRID:AB_2129575
WB (1:500)
Antibody Anti-DLK/MAP3K12 (Rabbit polyclonal) Thermo Fisher PA5-32173
RRID:AB_2549646
WB (1:500)
Antibody Anti-a-tubulin (Mouse monoclonal) Millipore sigma Cat # T9026
RRID:AB_477593
WB (1:2500)
Antibody Anti-Rabbit IgG Antibody (H+L), Peroxidase (Goat polyclonal) Vector Labs Cat # PI-1000
RRID:AB_2336198
WB (1:10000)
Antibody Anti-mouse IgG Antibody (H+L), Peroxidase (Horse polyclonal) Vector Labs Cat # PI-2000
RRID:AB_2336177
WB (1:10000)
Antibody Anti- H3K9me3S10P (Rabbit polyclonal) Abcam Cat # Ab5819
RRID:AB_305135
IF (1:250)
Antibody Anti-Beta-III Tubulin (Chicken polyclonal) Millipore Sigma Cat # AB9354
RRID:AB_570918
IF (1:1000)
Antibody Anti-γH2A.X (Mouse monoclonal) Cell Signalling Technologies Cat # 80312
RRID:AB_2799949
IF (1:100)
Antibody Anti-c-Fos (Rabbit polyclonal) Novus Cat # NB110-75039
RRID:AB_1048550
IF (1:125)
Antibody F(ab’)2 Anti-Mouse IgG (H+L) Alexa Fluor 647, (Goat polyclonal) Thermo Fisher Cat # A21237
RRID:AB_2535806
IF (1:1000)
Antibody F(ab’)2 Anti-Rabbit IgG (H+L) Alexa Fluor 555 (Goat polyclonal) Thermo Fisher Cat # A21425
RRID:AB_2535846
IF (1:1000)
Antibody Anti-Chicken IgY (H+L) Alexa Fluor 647 (Goat pAb) Abcam Cat # Ab150175
RRID:AB_2732800
IF (1:1000)
Antibody Anti-Chicken IgY (H+L) Alexa Fluor 488 (Goat polyclonal) Abcam Cat # Ab150173
RRID:AB_2827653
IF (1:1000)
Antibody F(ab’)2 Anti-Rabbit IgG (H+L) Alexa Fluor 488 (Goat polyclonal) Thermo Fisher Cat # A-11070
RRID:AB_2534114
IF (1:1000)
Antibody Anti-Mouse IL-1R (Goat polyclonal) Leinco Technologies Cat # I-736
RRID:AB_2830857
Blocking (2 ug/mL)
Sequence-based reagent mGAP F PMID:19515781 PCR primers CATGGCCTTCCGTGTGTTCCTA
Sequence-based reagent mGAP R PMID:19515781 PCR primers GCGGCACGTCAGATCCA
Sequence-based reagent ICP27 F PMID:21285374 PCR primers GCATCCTTCGTGTTTGTCATTCTG
Sequence-based reagent ICP27 R PMID:21285374 PCR primers GCATCTTCTCTCCGACCCCG
Sequence-based reagent ICP8 F PMID:23322639 PCR primers GGAGGTGCACCGCATACC
Sequence-based reagent ICP8 R PMID:23322639 PCR primers GGCTTAAATCCGGCATGAC
Sequence-based reagent ICP4 F This paper PCR primers TGCTGCTGCTGTCCACGC
Sequence-based reagent ICP4 R This paper PCR primers CGGTGTTGACCACGATGAGCC
Sequence-based reagent UL30 F PMID:22383875 PCR primers CGCGCTTGGCGGGTATTAACAT
Sequence-based reagent UL30 R PMID:22383875 PCR primers TGGGTGTCCGGCAGAATAAAGC
Sequence-based reagent UL48 F This paper PCR primers TGCTCGCGAATGTGGTTTAG
Sequence-based reagent UL48 R This paper PCR primers CTGTTCCAGCCCTTGATGTT
Sequence-based reagent gC F This paper PCR primers CAGTTTGTCTGGTTCGAGGAC
Sequence-based reagent gC R This paper PCR primers ACGGTAGAGACTGTGGTGAA
Sequence-based reagent shRNA: DLK-1 Broad Institute: Genetic Perturbation Platform/Millipore Sigma TRCN0000022573
Sequence-based reagent shRNA: DLK-2 Broad Institute: Genetic Perturbation Platform/Millipore Sigma TRCN0000022572
Sequence-based reagent shRNA: non-targeting control PMID:16873256
Commercial assay or kit Quick-RNA Miniprep Zymo Research R1054
Commercial assay or kit SuperScript IV First-Strand Synthesis System ThermoFisher 18091050
Commercial assay or kit SYBR Green PCR Master Mix ThermoFisher 4309155

Chemical compound, drug Acycloguanosine Millipore Sigma A4669 10 µM, 50 µM
Chemical compound, drug FUDR Millipore Sigma F-0503 20 µM
Chemical compound, drug Uridine Millipore Sigma U-3003 20 µM
Chemical compound, drug SP600125 Millipore Sigma S5567 20 µM
Chemical compound, drug GNE-3511 Millipore Sigma 533168 4 µM
Chemical compound, drug GSK-J4 Millipore Sigma SML0701 2 µM
Chemical compound, drug L-Glutamic Acid Millipore Sigma G5638 3.7 µg/mL
Chemical compound, drug Forskolin Tocris 1099 60 µM
Chemical compound, drug LY 294002 Tocris 1130 20 µM
Chemical compound, drug 666–15 Tocris 5661 2 µM
Chemical compound, drug SQ 22,536 Tocris 1435 50 µM
Chemical compound, drug KT 5720 Tocris 1288 3 µM
Chemical compound, drug TEA Tocris 3068 10 mM
Chemical compound, drug CsCl Tocris 4739 3 mM
Chemical compound, drug OG-L002 Tocris 6244 30 µM
Chemical compound, drug S2101 Tocris 5714 20 µM
Chemical compound, drug Tetrodotoxin Tocris 1069 1 µM
Chemical compound, drug ESI-09 Tocris 4773 10 µM
Chemical compound, drug ZD 7288 Cayman 15228 20 µM
Chemical compound, drug 8-bromo-cyclic AMP Cayman 14431 125 µM
Chemical compound, drug NGF 2.5S Alomone Labs N-100 50 ng/mL
Chemical compound, drug Primocin Invivogen ant-pm-1 100 µg/mL
Chemical compound, drug Aphidicolin AG Scientific A-1026 3.3 µg/mL
Chemical compound, drug IL-1β Shenendoah Bio. 100–167 30 ng/mL
Chemical compound, drug WAY-150138 Pfizer, gift from Lynn Enquist and Jay Brown. NA 10 µg/mL
Chemical compound, drug Fura-2 AM Thermo Fisher F1221 5 µM
Other Hoescht Stain Thermo 62249 2 µM