KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit polyclonal anti MAD-2 | (Essex et al., 2009) | OD72 |
| Rabbit polyclonal anti MAD-3 | This study | OD219-b |
| Rabbit polyclonal anti MAD-1 (aa 430–679) | (Moyle et al., 2014) | OD195-b |
| Rabbit polyclonal anti Cyclin B1 | Cell Signaling | Cat #12231S; RRID AB_2783553 |
| Rabbit polyclonal anti CDC-20 (aa 1–160) | (Kim et al., 2017) | OD220-b |
| Mouse monoclonal anti alpha-tubulin (clone DM1A) | Sigma-Aldrich | Cat #T9026; RRID AB_477593 |
| Rabbit polyclonal anti-Mad2 | Bethyl Laboratories | Cat #A300–301A; RRID AB_2281536 |
| Sheep polyclonal anti-Mad2 | (Tighe et al., 2008) | SM2.2 |
| Rabbit polyclonal anti BubR1 | (Kim et al., 2018) | N/A |
| Goat anti rabbit IgG, HRP-conjugated | Jackson Immunoresearch | Cat #111-035-003; RRID AB_2313567 |
| Donkey anti mouse IgG, HRP-conjugated | Jackson Immunoresearch | Cat #715-035-150; RRID AB_2340770 |
| Goat anti-mouse IgG, AP-conjugated | Promega | Cat #S372B; RRID AB_430871 |
| Donkey anti-sheep IgG, HRP-conjugated | Thermo Fischer | Cat #A16041; RRID AB_2534715 |
| Bacterial and Virus Strains | ||
| Lentivirus: PGK promoter-Myc-Mad2-P2A-BSD | This study | N/A |
| Chemicals, Peptides, and Recombinant Proteins | ||
| RO-3306 | (Vassilev et al., 2006) | Sigma-Aldrich Cat #217699–5MG |
| Experimental Models: Cell Lines | ||
| U2OS | ATCC | HTB-96 |
| U2OS GFP-PCNA and H2b-RFP | (de Groot et al., 2015) | ODCL0033 |
| U2OS GFP-PCNA and H2b-RFP; Myc-Mad2 | This study | ODCL0094 |
| U2OS CCNB1-mNeoNGreen | This study | ODCL0034 |
| Experimental Models: Organisms/Strains | ||
| C. elegans N2 Bristol | Caenorhabditis Genetics Center | N2 |
| emb-27(g48ts)II | Caenorhabditis Genetics Center | GG48 |
| mat-3(or344)III | Caenorhabditis Genetics Center | HY601 |
| unc-119(ed3) ltIs38 [pAA1; pie-1/GFP::PH(PLC1delta1); cb-unc-119 (+)]III; ltIs37 [pAA64; pie-1/mCherry::his-58; cb-unc- 119 (+)]IV | (Green et al., 2011) | OD95 |
| mdf-1(gk2)V/nT1(qIs51)(IV;V) | (Moyle et al., 2014) | OD738 |
| ltSi219[pOD1248/pSW076; Pmex-5::GFP-PH(PLC1delta1)-operon-linker-mCherry-his-11; cb-unc-119(+)]I; unc-119(ed3)III | (Wang et al., 2015) | OD866 |
| ltSi310[pOD1577/pMM7C; Pmdf-1::mdf-1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V | (Moyle et al., 2014) | OD1051 |
| ltSi608[pOD1583/pMM30; pmdf-1::GFP::mdf1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V | (Moyle et al., 2014) | OD1208 |
| ltSi608[pOD1583/pMM30; pmdf-1::GFP::mdf1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; ltIs37 [pAA64; pie-1/mCherry::his-58; unc-119 (+)] IV; mdf-1(gk2) V | (Moyle et al., 2014) | OD1209 |
| unc-119(ed3)III; ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | (Kim et al., 2015) | OD1702 |
| emb-27(g48)II; unc-119(ed3)?III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD1900 |
| unc-119(ed3?) mat-3(or344)III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | (Kim et al., 2017) | OD2003 |
| ltSi661[pPLG029; Pmdf-1::mdf-1(Q496A, I497A, F498A, H499A, M500A)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III mdf-1(gk2) V/nT1(qIs51) (IV;V) | This study | OD2061 |
| ltSi677 [pPLG034; Pmdf-1::GFP::mdf-1(delta 151–320)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2156 |
| ltSi677 [pPLG034; Pmdf-1::GFP::mdf-1(delta 151–320)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; ltIs37 [pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2157 |
| unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV | This study | OD2171 |
| san-1(lt6::loxP::cb-unc-119(+)::loxP)I; unc-119(ed3)?III | This study | OD2172 |
| unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD2174 |
| san-1(lt6::loxP::cb-unc-119(+)::loxP)I; unc-119(ed3)?III/hT2[bli-4(e937) let-?(q782) qIs48](I;III) | This study | OD2175 |
| unc-119(ed3?) mat-3(or344)III; mdf-1(gk2) ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V/nT1[qIs51](IV;V) | This study | OD2236 |
| ltSi587[pPLG024; Pmdf-2::mdf-2 delta intron 4::mdf-2 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD2300 |
| ltSi808[pPLG044; Pmdf-2::mdf-2 delta intron 4 R133E, Q134A::mdf-2 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD2453 |
| ltSi310[pOD1577/pMM7C; Pmdf-1::mdf-1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3?) mat-3(or344)III; mdf-1(gk2) ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V/nT1[qIs51](IV;V) | This study | OD2454 |
| ltSi661[pPLG029; Pmdf-1::mdf-1(Q496A, I497A, F498A, H499A, M500A)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3?) mat-3(or344)III; mdf-1(gk2) ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V/nT1[qIs51](IV;V) | This study | OD2458 |
| ltSi813[pPLG043; Pfzy-1::fzy-1 del 128–130::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | This study | OD2461 |
| san-1(lt6::loxP::cb unc-119(+)::loxP)I; unc-119(ed3?) mat-3(or344)III; ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD2577 |
| unc-119(ed3?) mat-3(or344)III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD2579 |
| ltSi822[pPLG051; Pfzy-1::fzy-1 A138V::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | This study | OD2580 |
| ltSi813[pPLG043; Pfzy-1::fzy-1 del 128–130::fzy-1 3’UTR; cb-unc-119(+)]I;fzy-1(lt20::loxP)II; unc-119(ed3)?III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD2583 |
| ltSi813[pPLG043; Pfzy-1::fzy-1 del 128–130::fzy-1 3’UTR; cb-unc-119(+)]I;fzy-1(lt20::loxP)II; unc-119(ed3?) mat-3(or344)III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD2584 |
| ltSi822[pPLG051; Pfzy-1::fzy-1 A138V::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)II; unc-119(ed3)?III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD2585 |
| ltSi822[pPLG051; Pfzy-1::fzy-1 A138V::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)II; unc-119(ed3?) mat-3(or344)III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | (Kim et al., 2017) | OD2586 |
| ltSi814[pPLG047; Pfzy-1::gfp::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; unc-119(ed3)?III;; ltIs37 [pAA64; pie-1/mCherry::his-58; unc-119 (+)] IV | (Kim et al., 2017) | OD2591 |
| ltSi825[pPLG052; Pmdf-2::mdf-2 delta intron 4::gfp::mdf-2 3’UTR; cb-unc-119(+)]II; unc-119(ed3)III?; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1[qIs51](IV;V) | This study | OD2663 |
| ltSi805[pPLG042; Pfzy-1::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | (Kim et al., 2017) | OD2664 |
| ltSi958[pPLG053; Pmdf-1::GFP::mdf-1 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2685 |
| ltSi958[pPLG053; Pmdf-1::GFP::mdf-1 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2686 |
| ltSi959[pPLG054; Pmdf-1::GFP::mdf-1 d151–320 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2687 |
| ltSi959[pPLG054; Pmdf-1::GFP::mdf-1 d151–320 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD2688 |
| ltSi805[pPLG042; Pfzy-1::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)II; unc-119(ed3)?III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | (Kim et al., 2017) | OD2692 |
| ltSi805[pPLG042; Pfzy-1::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)II; unc-119(ed3?) mat-3(or344)III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | (Kim et al., 2017) | OD2693 |
| emb-27(g48)II; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1[qIs51](IV;V) | This study | OD2832 |
| mat-3(or344) unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1[qIs51](IV;V) | This study | OD2835 |
| mdf-1(lt39[gfp::tev::loxP::3xFlag::mdf-1])V | (Wang et al., 2017) | OD2906 |
| unc-119(ed3?) mat-3(or344)III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV | This study | OD2919 |
| unc-119(ed3)?III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(lt39[gfp::tev::loxP::3xFlag::mdf-1])V | This study | OD2920 |
| unc-119(ed3?) mat-3(or344)III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(lt39[gfp::tev::loxP::3xFlag::mdf-1])V | This study | OD3004 |
| ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)III | This study | OD3328 |
| ltSi1069[pPLG184; Pcyb-1::cyb-1::cyb-1 3’-UTR]II; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD3336 |
| ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD3338 |
| san-1(lt6::loxP::cb-unc-119(+)::loxP)I; ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III | This study | OD3490 |
| ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; mat-3(or344) unc-119(ed3)?III | This study | OD3493 |
| ltSi1093[pPLG207; Pmdf-1::mdf-1::mdf-1 3’UTR; cb-unc-119(+)]I; ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2) V/nT1(qIs51)(IV;V) | This study | OD3537 |
| ltSi1096[pPLG208; Pmdf-1::mdf-1(Q496A, I497A, F498A, H499A, M500A)::mdf-1 3’UTR; cb-unc-119(+)]I; ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2) V/nT1(qIs51)(IV;V) | This study | OD3538 |
| ltSi1112[pPLG217; Pmex-5::gfp::pcn-1::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)III | This study | OD3549 |
| ltSi805[pPLG042; Pfzy-1::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP) ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | This study | OD3554 |
| mdf-2(lt104[mdf-2::gfp::tev::loxP::3xFlag])IV | This study | OD3637 |
| unc-119(ed3?)III; mdf-2(lt104[mdf-2::gfp::tev::loxP::3xFlag]) ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV | This study | OD3655 |
| cyb-3(lt110)V/nT1[qIs51](IV;V). | This study | OD3737 |
| cyb-1(gk35) IV/nT1[qIs51](IV;V) | This study | OD3739 |
| unc-119(ed3?) mat-3(or344)III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)] mdf-2(lt105[mdf-2::gfp::tev::loxP::3xFlag])IV | This study | OD3740 |
| ltSi1112[pPLG217; Pmex-5::gfp::pcn-1::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; cdk-1(ne2257) unc-119(ed3)?III | This study | OD3830 |
| ltSi1069[pPLG184; Pcyb-1::cyb-1::cyb-1 3’-UTR]II; unc-119(ed3)?III; cyb-1(gk35)IV/nT1[qIs51](IV;V) | This study | OD3837 |
| ltSi1138[pPLG240; Pcyb-3::cyb-3::cyb-3 3’UTR; cb-unc-119(+)]I; cyb-3(lt110)V/nT1[qIs51](IV;V) | This study | OD3838 |
| ltSi1138[pPLG240; Pcyb-3::cyb-3::cyb-3 3’UTR; cb-unc-119(+)]I; unc-119(ed3)?III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV/nT1(qIs51)IV;V | This study | OD3842 |
| cyb-2.2(tm1969)I; cyb-2.1(tm2027)IV | This study | OD3844 |
| ltSi1167[oxTi185; pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]I; unc-119(ed3)III | This study | OD3908 |
| ltSi1167[oxTi185; pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)] ltSi1138[pPLG240; Pcyb-3::cyb-3::cyb-3 3’UTR; cb-unc-119(+)]I; unc-119(ed3)?III | This study | OD3910 |
| ltSi1167[oxTi185; pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]I; ltSi1069[pPLG184; Pcyb-1::cyb-1::cyb-1 3’-UTR]II; unc-119(ed3)?III | This study | OD3911 |
| cyb-1(lt125[cyb-1::LAP::mNeonGreen::loxP::3xFlag])IV | This study | OD3913 |
| ltSi1167[oxTi185; pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]I; emb-27(g48ts)II; unc-119(ed3)?III | This study | OD3942 |
| ltSi310[pOD1577/pMM7C; Pmdf-1::mdf-1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-2(lt104[mdf-2::gfp::tev::loxP::3xFlag]) ltIs37[pAA64; pie-1/mCherry::his-58; unc-119(+)]IV; mdf-1(gk2)V | This study | OD4050 |
| ltSi976[pPLG063; Pmdf-1::mdf-1 delta 151–320::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-2(lt104[mdf-2::gfp::tev::loxP::3xFlag]) ltIs37[pAA64; pie-1/mCherry::his-58; unc-119(+)]IV; mdf-1(gk2) V | This study | OD4051 |
| ltSi587[pPLG024; Pmdf-2::mdf-2 delta intron 4::mdf-2 3’UTR; cb-unc-119(+)]II; unc-119(ed3)? mat-3(or344)III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV; ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD4058 |
| ltSi808[pPLG044; Pmdf-2::mdf-2 delta intron 4 R133E, Q134A::mdf-2 3’UTR; cb-unc-119(+)]II; unc-119(ed3)? mat-3(or344)III; mdf-2(lt4::loxP::cb-unc-119(+)::loxP)IV; ltSi560[oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD4059 |
| ltSi822[pPLG051; Pfzy-1::fzy-1 A138V::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP) ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | This study | OD4060 |
| ltSi1195[pPLG256; Pfzy-1::fzy-1 D433N::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP) ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III | This study | OD4062 |
| ltSi1195[pPLG256; Pfzy-1::fzy-1 D433N::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP)II; unc-119(ed3)?III; ltSi560 [oxTi365; pPLG014; Pmex-5::GFP::his-11::tbb-2_3’UTR, tbg-1::gfp::tbb-2_3’UTR; cb-unc-119(+)]V | This study | OD4063 |
| ltSi1200[pPLG262; Pmdf-1::GFP::mdf-1(Q496A, I497A, F498A, H499A, M500A)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; ltIs37[pAA64; pie-1/mCherry::his-58; unc-119 (+)]IV; mdf-1(gk2)V/nT1(qIs51)(IV;V) | This study | OD4071 |
| ltSi1088[oxTi185; pMO005; Pmex-5::mCherry::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR]I; ltSi608[pOD1583/pMM30; pmdf-1::GFP::mdf1::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2) V | This study | OD4083 |
| ltSi1088[oxTi185; pMO005; Pmex-5::mCherry::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR]I; ltSi677 [pPLG034; Pmdf-1::GFP::mdf-1(delta 151–320)::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; unc-119 (+)]IV; mdf-1(gk2)V | This study | OD4084 |
| ltSi1088[oxTi185; pMO005; Pmex-5::mCherry::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR]I; ltSi958[pPLG053; Pmdf-1::GFP::mdf-1 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119 (+)]IV; mdf-1(gk2)V | This study | OD4085 |
| ltSi1088[oxTi185; pMO005; Pmex-5::mCherry::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR]I; ltSi959[pPLG054; Pmdf-1::GFP::mdf-1 d151–320 R518A, K519A, R520A, K521A::mdf-1 3’UTR; cb-unc-119(+)]II; unc-119(ed3)?III; mdf-1(gk2)V | This study | OD4086 |
| unc-119(ed3)?III; cyb-1(lt125[cyb-1::LAP::mNeonGreen::loxP::3xFlag]) ltIs37[pAA64; pie-1/mCHERRY::his-58; unc-119 (+)]IV | This study | OD4100 |
| unc-119(ed3)?III; ltIs37[pAA64; pie-1/mCHERRY::his-58; unc-119 (+)]IV; cyb-3(lt135[mNeonGreen::tev::loxP::3xFlag::cyb-3])V | This study | OD4102 |
| ltSi813[pPLG043; Pfzy-1::fzy-1 del 128–130::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP) ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II/mIn1[mIs14 dpy-10(e128)]II; unc-119(ed3)?III | This study | OD4139 |
| ltSi965[pPLG058; Pfzy-1::fzy-1 T7A, T32A, S87A::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP) ltSi1066[pPLG187; Pmex-5::gfp::ph::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3)?III | This study | OD4192 |
| ltSi805[pPLG042; Pfzy-1::fzy-1::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP); ltSi1112[pPLG217; Pmex-5::gfp::pcn-1::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]II; unc-119(ed3?)III | This study | OD4225 |
| ltSi965[pPLG058; Pfzy-1::fzy-1 T7A, T32A, S87A::fzy-1 3’UTR; cb-unc-119(+)]I; fzy-1(lt20::loxP); ltSi1112[pPLG217; Pmex-5::gfp::pcn-1::tbb-2 3’-UTR::operon linker::mCherry::his-11::tbb-2 3’-UTR; cb-unc-119(+)]]II; unc-119(ed3?)III | This study | OD4226 |
| Oligonucleotides | ||
| CRISPR/Cas9 targeting sequences, see Table S1 | This paper | N/A |
| Primers for dsRNA production, see Table S2 | This paper | N/A |
| ON-TARGETplus Non-targeting Pool | Dharmacon | Cat # L-015475-00-0005 |
| Mad2 siRNA #1, CCUAUUGAAUCAGUUUCCAAUUU | (Ye et al., 2017) | N/A |
| Mad2 siRNA #2, CAGUAUAGGUAGGGAGAUAUU | (Ye et al., 2017) | N/A |
| ON-TARGETplus Human BUB1B siRNA - SMARTpool | Dharmacon | Cat # L-004101-00-0005 |
| Software and Algorithms | ||
| Fiji | (Schindelin et al., 2012) | RRID: SCR_002285 |
| Prism | Graphpad | RRID: SCR_002798 |