Table 2.

SLC35A2 somatic variants identified in the MOGHE cohort

Patient ID	HGVSc	HGVSp	Variant	Brain VAF (%) Gene panel	Brain VAF (%) Validation	M-CAP	CADD score
DE-1	c.206C > T	p.Thr69Ile	Missense SNV	14	5.75	D	23.8
DE-2	c.603_606dupAGGC	p.Leu203Argfs*20	Fs insertion	21	13.88	–	–
DE-3	c.569_572delGAGG	p.Gly190Alafs*158	Fs deletion	41	47.09	–	–
DE-4	c.335_339dupCGCTC	p.Lys114Argfs*32	Fs insertion	52	Sanger confirmed	–	–
DE-5	c.905C > T	p.Ser302Phe	Missense SNV	7	10.55	D	28.1
DE-6	c.580_616dupCCACTGGATCAGAACCCTGGGGCAGGCCTGGCAGCCG	p.Val206Alafs*28	Fs insertion	9	6.20	–	–
DE-7	c.359_360delTC	p.Leu120Hisfs*7	Fs deletion	30	Sanger confirmed	–	–
DE-8	c.112_116delinsTGGTGGTCCAGAATG	p.Ile38Trpfs*59	Fs indel	33	33.41	–	–
DE-9	c.935C > T	p.Ser312Phe	Missense SNV	33	33.02	D	26.9

All variants were validated by deep amplicon sequencing, except for samples from DE-4 and DE-7, for which Sanger sequencing was used. Patients DE-1 and DE-2 were previously reported and were identified as P8 and P3 respectively in [16]. No blood sample was available to confirm the brain specificity

Fs frameshift, VAF variant allele frequency, SNV single nucleotide variant, indel insertion and deletion, M-CAP Mendelian clinically applicable pathogenicity score prediction (v1.4), D possibly pathogenic, CADD combined annotation dependent depletion score (Phred, GRCh37-v1.6). SLC35A2 RefSeq Transcript: NM_005660