Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences used for sequencing and PCR reactions
| Allele | Application | Primer | Sequence (5′-3′) | Marker |
|---|---|---|---|---|
| ACE*16 | Sequencing | *16-seq-F | CTGGAGAGCCACTCCCATCCTTTCT | |
| *16-seq-R | GACGTGGCCATCACATTCGTCAGAT | |||
| PCR reactions | *16-F | AAGGAGAGGAGAGAGACTCAAGCAC | 5′-labeled biotin | |
| *16-R (M) | TCGAGACCATCCCGGCTAAAAC | 5′-labeled digoxin | ||
| *16-R (WT) | AACCACATAAAAGTGACTGTATCGG | 5′-labeled digoxin |
