Table 2.

The results of the next-generation sequencing of the patient

Variant gene	Location	Transcriptional exons	Nucleotide amino acids	Homozygous /heterozygous	Prevalence in Control population	Analysis of pathogenicity	Phenotype of mutation	Source
COL43A	chr2–228,144,556	NM-000091; exon29	c.2173A > G (p.K725E)	Het	Not reported	Uncertain	Alport syndrome; familial hematuria	Father
COQ8B	chr19–41,209,508	NM-024876; exon9	c.737G > A (p.S246N)	Het	0.00435	Uncertain	Type 9 nephrotic syndrome	Father
COQ8B	chr19–41,209,736-41,209,778	NM-024876; exon8	c.577-600del (p.193-200del)	Het	Not reported	Uncertain	Type 9 nephrotic syndrome	Mother

Sequencing analysis of the patient demonstrating the detection of c.737G > A (p.S246N) mutation in exon 9 and c.577-600del AGAGTTCTTGAAGAGGAGCTCGGC (p.193-200del) in exon 8 of the COQ8B gene