Global mapping of translation initiation sites by TIS profiling in budding yeast

. 2020 Dec 30;2(1):100250. doi: 10.1016/j.xpro.2020.100250

REAGENT OR RESOURCE	SOURCE	IDENTIFIER
Chemicals, peptides, and recombinant proteins

DEPC-treated water	Growcells	UPW-0500
Cycloheximide (CHX)	Sigma-Aldrich	C1988
Lactimidomycin (LTM)	Sigma-Aldrich	506291
1 M Tris-HCl pH 7	Invitrogen	AM9850G
1 M Tris-HCl pH 7.5	Teknova	T5075
1 M Tris-HCl pH 8	Invitrogen	AM9855G
2 M KCl	Invitrogen	AM9640G
1 M MgCl₂	Invitrogen	AM9530G
5 M NaCl	Invitrogen	AM9760G
Triton X-100 detergent	Millipore	648466
Sucrose, ultra-pure	MP biomedicals	821713
Acid-phenol:chloroform, pH 4.5	Invitrogen	AM9722
Chloroform	Fisher Scientific	C606-1
NaOAc, pH 5.5	Invitrogen	AM9610
Isopropanol	Fisher Scientific	A416-1
Ethanol	Koptec	V1016
SUPERase·In	Invitrogen	AM2694
GlycoBlue	Invitrogen	AM9515
0.5 M EDTA	Invitrogen	15575-038
Ultra-pure dithiothreitol (DTT)	Invitrogen	15508013
RNase I	Invitrogen	AM2295
SDS	Bio-Rad	1610302
Growth media	N/A	N/A
Novex TBE-Urea Sample Buffer (2×)	Invitrogen	LC6876
10 bp DNA step ladder	Promega	G447A
15% TBE-urea gel	Invitrogen	EC68852BOX
10% TBE-urea gel	Invitrogen	EC68752BOX
8% TBE gel	Invitrogen	EC62152BOX
10× TBE buffer	Invitrogen	AM9863
SYBR gold nucleic acid gel stain	Life Technologies	S11494
Spin-X centrifuge tube filter columns	Costar	8162
T4 PNK + 10× T4 PNK buffer	NEB	M0201S
E.coli polyA polymerase + buffer + ATP	NEB	M0276S
Sodium hydroxide (pellets)	Fisher Scientific	S318-500
HCl	Fluka	318949-500ML
Tween20	VWR	M147-1L

Experimental models: organisms/strains

Saccharomyces cerevisiae, SK1 (our study)	N/A	N/A

Critical commercial assays

SuperScript III Reverse Transcriptase + 5× First Strand Buffer, 0.1 M DTT	Invitrogen	18080093
Phusion High-Fidelity DNA Polymerase + 5× HF buffer	NEB	M0530S
CircLigase ssDNA Ligase + CircLigase 10× Reaction Buffer, 1 mM ATP, 50 mM MnCl₂	Lucigen	CL4115K

Oligonucleotides

28-mer control oligo^a 5′AUGUACACGGAGUCGACCCGCAACGCGA3′	Integrated DNA Technologies	N/A
31-mer control oligo^a 5′AUGUACACGGAGUCGAGCACCCGCAACGCGA/3Phos/3′	Integrated DNA Technologies	N/A
asDNA1b^b 5′/biosg/GATCGGTCGATTGTGCACC3′	Integrated DNA Technologies	N/A
asDNA2b^b 5′/biosg/CCGCTTCATTGAATAAGTAAAGAAAC3′	Integrated DNA Technologies	N/A
asDNA3b^b 5′/biosg/GACGCCTTATTCGTATCCATCTATA3′	Integrated DNA Technologies	N/A
RT primer^a^,^c 5′/5Phos/AGATCGGAAGAGCGTCGTGTA GGGAAAGAGTGT/iSp18/GTGACTGGAGTTC AGACGTTTTTTTTTTTTTTTTTTTTVN/3′ iSp18 = internal spacer 18 from IDT	Integrated DNA Technologies	N/A
PCR forward primer^a^,^c 5′AATGATACGGCGACCACCGAGATC TACACTCTTTCCCTACACGACGCTCT TCCGATCT 3′	Integrated DNA Technologies	N/A
Index primers^a^,^c 5′CAAGCAGAAGACGGCATACGAGATXX XXXXXXGTGACTGGAGTTCAGACG3′ “XXXXXXXX” = Illumina barcodes	Integrated DNA Technologies	N/A
asDNA1b^b (from Ingolia et al., 2012) 5′/biosg/GATCGGTCGATTGTGCACC3′ biosg = 5′biotin with standard linker from IDT (C6)	Integrated DNA Technologies	N/A
asDNA2b^b (from (Ingolia et al., 2012)) 5′/biosg/CCGCTTCATTGAATAAGTAAAG AAAC3′ biosg = 5′biotin with standard linker from IDT (C6)	Integrated DNA Technologies	N/A
asDNA3b^b (from (Ingolia et al., 2012)) 5′/biosg/GACGCCTTATTCGTATCCAT CTATA3′ biosg = 5′biotin with standard linker from IDT (C6)	Integrated DNA Technologies	N/A

Other

30°C warm room (for budding yeast meiotic samples)	N/A	N/A
Culture flasks (for budding yeast samples)	N/A	N/A
Shaker (for budding yeast samples)	N/A	N/A
Styrofoam box	N/A	N/A
50 mL centrifuge tube	Corning	430829
Vacuum pump	N/A	N/A
2 mL micro tube	Sarstedt	72.694.006
Rack for 50 mL tubes	N/A	N/A
BD Precisionglide needle 20G	Sigma-Aldrich	305175
Liquid N₂	N/A	N/A
Large flat metal spatula	N/A	N/A
Long tweezers	N/A	N/A
All-glass filter holder kit	Millipore Sigma	XX1514700
Nitrocellulose nitrate membranes, 0.45um pore size	Whatman	7184-009
Latex/nitrile gloves in your size and a size or two larger	N/A	N/A
Cryogloves	N/A	N/A
Metal tongs	N/A	N/A
Kimwipes	Kimtech	34155
Paper towels	N/A	N/A
Retsch MM400 mixer mill	Retsch	20.745.0001
Grinding jars MM 400, 50 mL	Retsch	01.462.0216
Grinding balls, 25 mm	Retsch	05.368.0105
Curved small spatulas (two per sample)	N/A	N/A
30°C water bath	N/A	N/A
Centrifuge for 50 mL tubes	N/A	N/A
Centrifuge for 1.5 mL tubes	N/A	N/A
Ultrospec 2100 pro spectrophotometer	Amersham Biosciences	23064
XL-70 ultracentrifuge	Beckman Coulter	N/A
SW41 Ti swinging bucket rotor and buckets	Beckman Coulter	331362
Gradient master system^d	BIOCOMP Instruments	N/A
Ultracentrifuge tubes, 12 mL	Seton	7030
Duster compressed gas	Falcon	DPSXL-7140D
10 mL syringe	N/A	N/A
Serological pipets	N/A	N/A
Thermomixer C heatblock	Eppendorf	N/A
1.5 mL low-adhesion microcentrifuge tubes	USA Scientific	1415-2600
1.5 mL Non-stick RNase-free microfuge tubes	Ambion	AM12450
0.5 mL Non-stick RNase-free microfuge tubes	Ambion	AM12350
SafeImager 2.0	Invitrogen	G6600
Saran wrap	N/A	N/A
Bio-Rad Geldoc XR+	Bio-Rad	1708195
Dynabeads MyOne Streptavidin C1	Invitrogen	65001
DynaMag-1 magnet	Invitrogen	12321D

PAGE-purified.

HPLC-purified.

The amplification primers were designed and validated by Calvin Jan and generously shared with us. The original RT primer was also designed and validated by Calvin Jan for linker ligation (see note under Poly(A)-tailing in the Step-by-step method details section) but modified to be compatible with poly(A)-tailing.

We use the BIOCOMP Gradient master system (with accessories including plotting software) that includes the gradient master for gradient formation, and the piston gradient fractionator. We use the Bio-Rad EM-1 Econo (Bio-Rad, 7318160) as the UV monitor and the Model 2110 Fraction Collector (Bio-Rad, 7318122) at our gradient station. Other UV monitors and fraction collectors may be used if compatible with the gradient station.