KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Mouse monoclonal anti-MR1-biotin (clone 26.5) | Jose Villadangos, The Peter Doherty Institute of Infection and Immunity, The University of Melbourne (McWilliam et al., 2016) | N/A |
| Human recombinant anti-HLA-ABC-PE (clone REA230) | Miltenyi Biotec | Cat# 130-120-055; RRID: AB_2751977 |
| Mouse monoclonal IgG2a-biotin (clone 8A5) isotype | Jose Villadangos, The Peter Doherty Institute of Infection and Immunity, The University of Melbourne | N/A |
| Mouse monoclonal anti-MR1-PE (clone 26.5) | Biolegend | Cat# 361105; RRID: AB_2563042 |
| Mouse anti-IgG2a PE κ isotype (clone G155–178) | BD Biosciences | Cat# 555574; RRID: AB_395953 |
| Mouse monoclonal anti-HLA-ABC-APC (clone G46–2.6) | BD Biosciences | Cat# 555555; RRID: AB_398603 |
| Mouse anti-IgG1 APC κ isotype (clone MOPC-21) | BD Horizon | Cat# 555751; RRID: AB_398613 |
| Mouse monoclonal anti-CD69-BV421 (clone FN50) | BD Biosciences | Cat# 562884; RRID: AB_2687422 |
| Mouse anti-IgG1 BV421 κ isotype | BD Horizon | Cat# 562438; RRID: AB_11207319 |
| Rabbit polyclonal Anti-MR1-CT, generated against the final 15 residues of human MR1 cytosolic tail (PREQNGAIYLPTPDR) | Jose Villadangos, The Peter Doherty Institute of Infection and Immunity, The University of Melbourne (McWilliam et al., 2016) | N/A |
| Mouse monoclonal anti-MR1 | Abcam | Cat# ab55164; RRID: AB_944260 |
| Mouse monoclonal anti-HLA-ABC (clone EMR8–5) | Abcam | Cat# ab70328; RRID: AB_1269092 |
| Mouse monoclonal anti-GFP (B-2) | Santa Cruz Biotechnology | Cat# sc-9996; RRID: AB_627695 |
| Rabbit polyclonal anti-GAPDH (FL-335) | Santa Cruz Biotechnology | Cat# sc-25778; RRID: AB_10167668 |
| Mouse monoclonal anti-HSV-1 ICP0 (clone 11060) | Santa Cruz Biotechnology | Cat# sc-53070; RRID: AB_673704 |
| Mouse monoclonal anti-gD-FITC | Virostat | Cat# 0196 |
| Zombie NIR Fixable Viability Kit | Biolegend | Cat# 423105t |
| Streptavidin-PE | eBioscience | Cat# 12-4317-87 |
| Streptavidin-APC | eBioscience | Cat# 17-4317-82 |
| Bacterial and Virus Strains | ||
| HSV-1 Strain F | Dr Russell Diefenbach (Macquarie University) | GenBank: GU734771 |
| HSV-1 Strain 17 | Prof Roger Everett (University of Glasgow) | GenBank: NC_001806 |
| HSV-1 Strain KOS | Dr P Kinchington, Departments of Ophthalmology, and of Molecular Microbiology and Genetics, University of Pittsburgh | GenBank: JQ780693 |
| HSV-1 Strain 17 ICP0 mutant | Prof Roger Everett (University of Glasgow) (Everett et al., 2004) | N/A |
| HSV-1 Strain 17 vhs mutant | Prof Roger Everett (University of Glasgow) (Fenwick and Everett, 1990) | N/A |
| HSV-1 Strain KOS Us3 mutant | This study | N/A |
| MCMV Murine Cytomegalovirus Smith strain | Prof William Rawlinson (University of New South Wales) (Rawlinson et al., 1996) | GenBank: U68299 |
| HCMV Human cytomegalovirus (Merlin strain) derived from BAC clone pAL1111 | Dr Richard Stanton (Cardiff University) | GenBank: GU179001 |
| Human adenovirus serotype 5 derived from BAC clone pAL908 | (McSharry et al., 2008) | N/A |
| Human adenovirus serotype 5 ΔE3/19K mutant derived from BAC clone pAL918 | (McSharry et al., 2008) | N/A |
| 5-alpha Competent E. coli | NEB | Cat# C2987H |
| E. coli (DH5α) | ThermoFisher Scientific | Cat# 18265017 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Dulbecco’s Modified Eagle’s Medium | Lonza | Cat# 12–604F |
| Fetal Calf Serum | Sigma-Aldrich | Cat# 12003C |
| Ac-6-FP Acetyl-6-formylpterin | Schircks | Cat# 11.418 |
| 5-A-RU 5-amino-6-D-ribitylaminouracil | Dr Hamish McWilliam (Corbett et al., 2014) | N/A |
| MG Methylglyoxal | Sigma-Aldrich | Cat# M0252 |
| MG132 | Sigma-Aldrich | Cat# M7449 |
| PS-341 | Selleck Chemicals | Cat# S1013 |
| Fugene HD | Promega | Cat# E2231 |
| Polybrene | Sigma-Aldrich | Cat# TR-1003 |
| folate free RPMI1640 | Lonza | Cat# 12–702F |
| Endo H | NEB | Cat# P0703S |
| BglII | NEB | Cat# R0144 |
| BamHI-HF | NEB | Cat# R3136 |
| SpeI-HF | NEB | Cat# R3133 |
| XbaI | NEB | Cat# R0145 |
| T4 DNA ligase NEB | NEB | Cat3 M0202 |
| Critical Commercial Assays | ||
| GFX PCR DNA and Gel Band Purification Kit | GE Healthcare Life Sciences | Cat# 28903470 |
| NucleoSpin® Gel and PCR Cleanup | Macherey-Nagal | Cat# 740609 |
| Experimental Models: Cell Lines | ||
| Human fibroblasts HFF-1 (male) | ATCC | SCRC-1041; RRID: CVCL_3285 |
| Human ARPE-19 cell line (male) | ATCC | CRL-2302; RRID: CVCL_0145 |
| Human 293T cell line (female) | ATCC | CRL-3216; RRID: CVCL_0063 |
| Human 293 cell line (female) | ATCC | CRL-1573; RRID: CVCL_0045 |
| Green monkey Vero cell line (female) | ATCC | CCL-81; RRID: CVCL_0059 |
| Human U2OS cells (female) | Prof Roger Everett, (University of Glasgow) (Everett et al., 2004) | N/A |
| Murine NIH 3T3 fibroblasts (male) | Prof William Rawlinson (University of New South Wales) | N/A |
| Human Jurkat MAIT (male) | Prof James McCluskey (Reantragoon et al., 2012) | N/A |
| Human A549 (male) | ATCC | Cat# CCL-185; RRID: CVCL_0023 |
| HFF-1 MR1 (male) | This study | N/A |
| ARPE-19 MR1 (male) | This study | N/A |
| ARPE-19 MR1-GFP (male) | This study | N/A |
| Oligonucleotides | ||
| Us3 Forward primer 5′ GTCTACACTAGTATGGCCTGTCGTAAGTTTTGTCG 3′ | This study | N/A |
| Us3 Reverse Primer 5′ GTCTACAGATCTTTTCTGTTGAAACAGCGGCAAAC 3′ | This study | N/A |
| Recombinant DNA | ||
| pSY10-Us3 | This study | N/A |
| pCDH_EF1-MCS-T2A-copGFP vector | Systems Bioscience, USA | Cat3# CD526A-1 |
| pMIG-MR1 | (McWilliam etal., 2016) | N/A |
| pMIG-MR1-GFP | (McWilliam etal., 2016) | N/A |
| Software and Algorithms | ||
| FlowJo software | Treestar Inc. | https://www.flowjo.com/ |
| Paired Student’s t tests or ANOVA analysis performed as indicated using Prism software | GraphPad | https://www.graphpad.com/scientific-software/prism/ |
| CLC Main Workbench | QIAGEN | https://digitalinsights.qiagen.com/products-overview/analysis-andvisualization/qiagen-clc-main-workbench/ |