Table 1. Primers used to amplify capripoxvirus- and LSDV-specific gene segments.
Oligos | Gene/ORF | Primers | Product size (bp) | Thermocycler |
---|---|---|---|---|
Capripoxvirus | P32 | Forward: 5'-GGAATGATGCCRTCTARATTC-3' | 199 | Annealing = 55°C |
Reverse: 5'-CCCTGAAACATTAGTATCTGT-3' | Extension = 30 s | |||
LSDV | ORF 011 | Forward: 5'-ATGAATTATACTCTTAGYACAGTTAG-3' | 1134 | Annealing = 52°C |
Reverse: 5'-TTATCCAATGCTAATACTACCAG-3' | Extension = 80 s | |||
ORF 012 | Forward: 5’- ATGGAAAAGGAAAAATTATGTAGCG -3’ | 636 | Annealing = 52°C | |
Reverse: 5’- TTATTGTTTGTCAAAAAAGGTGAGATTTC -3’ | Extension = 40 s | |||
ORF 036 | Forward: 5’- ATGGATGATGATAATACTAATTCATATAG -3’ | 606 | Annealing = 52°C | |
Reverse: 5’- TTATTTTTCTACAGCTCTAAACTTCG -3’ | Extension = 40 s |