Skip to main content
. 2021 Jan 2;20(1):e13295. doi: 10.1111/acel.13295

TABLE 1.

Key Resources Table. Table showing details of reagents used in the Experimental Procedures

Reagent Source Species Identifier Clone
Antibodies—anti‐human Invitrogen Anti‐human 45–0037–42 OKT3
CD3‐PerCPCy5.5 eBioscience Anti‐human 56–0048–82 OKT4
CD4‐AF700 eBioscience Anti‐human 56–0049–41 RPA‐T4
CD45RA‐FITC BioLegend Anti‐human 304106 HI100
CD27‐PECy7 BioLegend Anti‐human/mouse 123216 LG.3A10
CXCR5‐PE BioLegend Anti‐human 356904 D252D4
ICOS‐APC eBioscience Anti‐human 17–9948–42 ISA−3
PD−1‐AF647 BioLegend Anti‐human 329910 EH12.2H7
IRF4‐PE BioLegend Anti‐human, mouse, rat 646404 IRF4.3F4
BCL6 BD Anti‐human, mouse, rat 561522 KI 12–91
CD3 BD Bioscience Anti‐human 300402 UCHT1
CD28 Invitrogen Anti‐human 16–0289–85 CD28.1
pCD247 Invitrogen Anti‐human, mouse, rat 12–28–41 32BR45
pErk‐PE BD Bioscience Anti‐human 612566 20A
pS6‐AF647 Cell Signalling Anti‐human 48s1 s D57.2.2E
CD25‐APC eBioscience Anti‐human 17–0259–41 BC96
CD28 eBioscience Anti‐human 302912 CD28.2
CD28 BD Pharmingen Anti‐human 555726 CD28.2
CD3 BioLegend Anti‐human 300401 UCHT1
IFNg eBioscience Anti‐human 25–7319–41 45.B3
IL−21 eBioscience Anti‐human 12–7219–42 eBIO3A3‐N2
Notch1‐PE BD Anti‐mouse 552768 mN1A
Actin Sigma Anti‐human, mouse, rat A5441 AC−15
Notch1 BD Pharmingen Anti‐human 563421 MH1 N1‐519
Notch2 BioLegend Anti‐human 34803 MHN2‐25
Activin A RnD Systems Anti‐human, mouse, rat MAB3381 69403
IL−12 p70 RnD Systems Anti‐human MAB219 24916
IL−12p35 Invitrogen Anti‐human 14–7128–82 BT21
TGFB RnD Systems Anti‐human MAB1835 1D11
pStat5‐PE eBioscience Anti‐human/mouse 12–9010–42 SRBCZX
pStat3‐AF647 BD Pharmingen Anti‐human 557815 pY705
Fc block eBioscience Anti‐human 14–9161–73 N/A
Antibodies ‐ anti‐mouse
CD3‐PerCPCy5.5 Invitrogen Anti‐mouse 45–0031–82 145‐2C11
CD4‐APC Invitrogen Anti‐mouse 17–0041–83 GK1.5
CD44‐AF700 BioLegend Anti‐mouse 103026 Im7
CD62L‐PECy7 eBioscience Anti‐mouse 25–0621–82 Mel14
IRF4 BioLegend Anti‐human, mouse, rat 646404 IRF4.3F4
BCL6‐PE BD Anti‐human, mouse, rat 561522 KI 12–91
BCL6‐PECy7 BD Anti‐human, mouse, rat 583582 KI 12–91
CXCR5‐APC BioLegend Anti‐mouse 145506 L138D7
FoxP3‐APC Invitrogen Anti‐mouse 17–5773–82 FKJ−16S
PD−1‐PECy7 BioLegend Anti‐mouse 109110 RMP1‐30
Va2 Invitrogen Anti‐mouse 17–5812–82 20.1
CD45.1‐PECy7 eBioscience Anti‐mouse 25–0453–82 A20
CD45.2‐PerCPCy5.5 eBioscience Anti‐mouse 45–0454–82 104
CD4‐BV605 BioLegend Anti‐mouse 100547 RM4‐5
PD−1‐e780 eBioscience Anti‐mouse 47–9985–82 J43
CXCR5‐BV421 BioLegend Anti‐mouse 145512 38D7
B220‐BV785 BioLegend Anti‐mouse 103246 RA3‐6B2
CD19‐PerCPCy5.5 BioLegend Anti‐mouse 115533 6D5
B220‐BV510 BioLegend Anti‐mouse 103247 38D7
CD44‐PerCPCy5.5 BioLegend Anti‐mouse 103032 IM7
Ki67‐AF700 Invitrogen Anti‐mouse/human 56–5698–82 SolA15
Ki67‐FITC Invitrogen Anti‐mouse/human 11–5698–82 SolA15
CD4‐PerCPCy5.5 Invitrogen Anti‐mouse 45–0042–82 RM4‐5
CD4‐APC Invitrogen Anti‐mouse 17–0041–83 GK1.5
Fc block Invitrogen Anti‐mouse 14–0161–82 91
live/dead‐e780 Invitrogen N/A 65–0865–14 N/A
Enrichment kits
Magnisort Human Naïve CD4+ Cell Enrichment Kit Invitrogen Human N/A 8804–6814–74
Magnisort Murine Naïve CD4+ Cell Enrichment Kit Invitrogen Murine N/A 8804–6824–74
Real‐time PCR primers
Taqman probes
FOXP3 Invitrogen Human Hs01085334
RBPJ Invitrogen Human Hs00794653
BCL6 Invitrogen Human Hs00153368
TBX21 Invitrogen Human Hs00894392
PRDM1 Invitrogen Human Hs00153357
18S Invitrogen Human Hs03003631
B2 M Invitrogen Human Hs99999907
SYBR green‐based primers
CMAF Bio‐Rad Human 10025636 qHsaCDD0047317
Forward primer Reverse primer
GAPDH Sigma Human ACAGTTGCCATGTAGACC TTTTTGGTTGAGCACAGG
VCP Sigma Human TAGAGGAATCCTGCTTTAG CCATTGATCAAGAAGAAGAAGG
CXCL13 Sigma Human GAGGCAGATGGAACTTGAGC CTGGGGATCTTCGAATGCTA
IL21 Sigma Human GAATGCGTCCTTATAGA GTCTCTACATCTTCTGGA