Table 1.
Primers and probes used for PCR-based assays for detection of the germline APC variant
| Sequence | Product size (bp) | ||||
|---|---|---|---|---|---|
| Primers used for PCR-direct sequencing | |||||
| Primers | sense | 5′- | AGTCCCACCTTCAAAAATCC | −3’ | 385 |
| antisense | 5′- | AACTAAAAATGCAATTATCTTGAATG | −3’ | ||
| Primers used for PCR-RFLP and PCR-directsequencing of FFPE samples | |||||
| Primers | sense | 5′- | TCTTTTGGCATTGTGTAAACTTG | −3’ | 156 |
| antisense | 5′- | CTTACATTTTCAGTTAAAGGGAGACT | −3’ | ||
| Primers and probes used for Taq-Man duplex real-time PCR assay | |||||
| Primers | sense | 5′- | TTTAGTGAGATTCTGAAGTTGAGCATAATA | −3’ | 78 |
| antisense | 5′- | TCATTACTTCTTGCTGATCTTGACAA | −3’ | ||
| Probe for Wild-type allele | 5′- | (VIC)- CAATCTTTTTCCTTTTC-(MGB) | −3’ | ||
| Probe for Mutant allele | 5′- | (FAM)-CAATCTTAATCCTTTTC-(MGB) | −3’ | ||
VIC 2-chloro-7’-phenyl-1,4-dichloro-6-carboxy-fluorescein, FAM 6-carboxyfluorescein, NFQ nonfluorescent quencher, MGB minor groove binder