Appendix 1—key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo sapiens) | HEK293T | ATCC | CRL-11268 | |
| Cell line (Homo sapiens) | Jurkat, Clone E6-1 | ATCC | TIB-152 | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1 | This paper | CRISPR/Cas9 generated monoclonal Jurkat cell line | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2 | This paper | CRISPR/Cas9 generated monoclonal Jurkat cell line | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, re-expressing KIF21B-GFP | This paper | Polyclonal line re-expressing KIF21B-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, re-expressing KIF21B-GFP | This paper | Polyclonal line re-expressing KIF21B-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat cells (control), expressing EB3-GFP | This paper | Polyclonal Jurkat (control) line expressing EB3-GFP | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, expressing EB3-GFP | This paper | Polyclonal line expressing EB3-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, expressing EB3-GFP | This paper | Polyclonal line expressing EB3-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat cells (control), expressing β-tubulin-GFP | This paper | Polyclonal Jurkat (control) line expressing β-tubulin-GFP | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#1, expressing β-tubulin-GFP | This paper | Polyclonal line expressing β-tubulin-GFP; generated from monoclonal KIF21B KO#1 Jurkat cells | |
| Cell line (Homo sapiens) | Jurkat, KIF21B KO#2, expressing β-tubulin-GFP | This paper | Polyclonal line expressing β-tubulin-GFP; generated from monoclonal KIF21B KO#2 Jurkat cells | |
| Transfected construct (Homo sapiens) | KIF21B-GFP | This paper | Lentiviral construct to transfect and express KIF21B-GFP in Jurkat cells |
|
| Transfected construct (Homo sapiens) | EB3-GFP | Bouchet et al., 2016; PMID:27939686 | Lentiviral construct to transfect and express EB3-GFP in Jurkat cells |
|
| Transfected construct (Homo sapiens) | β-tubulin-GFP | Bouchet et al., 2016; PMID:27939686 | Lentiviral construct to transfect and express β-tubulin-GFP in Jurkat cells |
|
| Transfected construct (Homo sapiens) | EB3-mCherry | Stepanova et al., 2003; PMID:12684451 | Expression construct transfected in Jurkat cells | |
| Sequence-based reagent | gRNA targeting sequence against KIF21B | This paper | gRNA sequence | caccgTGTGTGAGCAAGCTCATCGA |
| Sequence-based reagent | GAPDH_fw | This paper | qPCR primer | CAACGGATTTGGTCGTATT |
| Sequence-based reagent | GAPDH_rev | This paper | qPCR primer | GATGGCAACAATATCCACTT |
| Sequence-based reagent | IL-2_fw | This paper | qPCR primer | AACTCACCAGGATGCTCACATTTA |
| Sequence-based reagent | IL-2_rev | This paper | qPCR primer | TCCCTGGGTCTTAAGTGAAAGTTT |
| Antibody | Anti-CD3, clone UCHT1 (mouse monoclonal) | StemCell Technologies | Cat# #60011 | Coverslip coating (10 μg/mL) WB (1:400) |
| Antibody | Anti-HA, clone 16B12 (mouse monoclonal) | Biolegend (Covance) | Cat# MMS-101P, RRID:AB_10064068 | Coverslip coating (10 μg/mL) |
| Antibody | anti-KIF21B (rabbit polyclonal) | Sigma-Aldrich | Cat# HPA027249, RRID:AB_10602241 | WB (1:1000) |
| Antibody | Anti-GFP (rabbit polyclonal) | Abcam | Cat# Ab290, RRID:AB_303395 | WB (1:5000) |
| Antibody | Anti-Ku80 (mouse monoclonal) | BD Bioscience | Cat# 611360, RRID:AB_398882 | WB (1:2000) |
| Antibody | Anti- Lamtor4, clone D6A4V (rabbit monoclonal) | Cell Signalling Technology | Cat# 12284, RRID:AB_2797870 | IF (1:200) |
| Antibody | anti-CEP135 (rabbit polyclonal) | Sigma-Aldrich | Cat# SAB4503685; RRID:AB_10746232 | IF (1:200) |
| Antibody | Anti- α-tubulin, clone EP1332Y (rabbit monoclonal) | Abcam | Cat# ab52866, RRID:AB_869989 | IF (1:250) for ExM samples |
| Antibody | Anti-α-tubulin (mouse monoclonal) | Sigma-Aldrich | Cat# T6199, RRID:AB_477583 | IF (1:250) for STED samples WB (1:10000) |
| Antibody | Anti- α-tubulin, clone γL1/2 (rat monoclonal) | Abcam | Cat# Ab6160, RRID:AB_305328 | IF (1:300) |
| Antibody | Alexa Fluor 488-, 594- and 647- secondaries | Molecular Probes | IF (1:200 – 1:400) | |
| Antibody | IRDye 680LT and 800CW secondaries | Li-Cor Biosciences | WB (1:10000) | |
| Commercial assay or kit | Amaxa Cell Line Nucleofector kit V | Lonza | Cat# VPB-1002 | program X-001 or X-005 |
| Commercial assay or kit | iScript cDNA synthesis kit | Bio-Rad | Cat# 1708891 | |
| Commercial assay or kit | SYBR Select mastermix | Life Technologies | Cat# 44-729-19 | |
| Peptide, recombinant protein | Proteinase-K | Thermo Fisher | Cat# EO0491 | |
| peptide, recombinant protein | Monomeric GFP | This paper | Obtained from HEK293T lysates containing overexpressed eGFP. (Clontech pEGFP-C1 vector) | |
| Chemical compound, drug | acryloyl X-SE (AcX) | Thermo Fisher | Cat# A20770 | |
| Chemical compound, drug | sodium acrylate | Sigma-Aldrich | Cat# 408220 | |
| Chemical compound, drug | AA/BIS solution | Sigma-Aldrich | Cat# A3699 | |
| Chemical compound, drug | BIS | Sigma-Aldrich | Cat# M1533 | |
| Chemical compound, drug | cOmplete protease inhibitor cocktail | Roche | Cat# 4693132001 | |
| Chemical compound, drug | Puromycin | InvivoGen | Cat# ant-pr5b | (2 μg/mL) |
| Chemical compound, drug | Hygromycin | Invivogen | Cat# ant-hm | (100 μg/mL) |
| Chemical compound, drug | Polybrene | Merck-Millipore | Cat# TR-1003-G | (8 μg/mL) |
| Chemical compound, drug | Poly-D-Lysine | Thermo Fisher | Cat# A3890401 | |
| Chemical compound, drug | Vinblastine | Sigma-Aldrich | Cat# V1377 | |
| Chemical compound, drug | Phorbol 12-myristate 13-acetate (PMA) | Sigma-Aldrich | Cat# P8139 | |
| Chemical compound, drug | ionomycin | Sigma-Aldrich | Cat# I0634 | |
| Chemical compound, drug | TRIzol | Thermo Fisher Scientific | Cat# 15596026 | |
| Software, algorithm | GraphPad Prism | GraphPad Prism (https://graphpad.com) | RRID:SCR_015807 | |
| Software, algorithm | FIJI/ImageJ | FIJI/ImageJ (https://imagej.net/Fiji) | RRID:SCR_002285 | |
| Software, algorithm | ImageJ detection of molecules plugin (DoM) | Chazeau et al., 2016; PMID:26794511 | ||
| Software, algorithm | ImageJ KymoResliceWide plugin | https://github.com/ekatrukha/KymoResliceWide | ||
| Software, algorithm | ImageJ radiality plugin | Martin et al., 2018; PMID:29547120 | https://github.com/ekatrukha/radialitymap | |
| Software, algorithm | MetaMorph | Molecular Devices | RRID:SCR_002368 | |
| Software, algorithm | Leica Application Suite X | Leica Microsystems | RRID:SCR_013673 | |
| Software, algorithm | Micro-Manager | https://micro-manager.org/ | RRID:SCR_016865 | |
| Software, algorithm | Huygens Software | Scientific Volume Imaging https://svi.nl/HuygensSoftware | RRID:SCR_014237 | Drift correction of ExM sample acquisitions |
| Software, algorithm | Imaris, version 9.5.1 | Bitplane/Oxford instruments | RRID:SCR_007370 | |
| Software, algorithm | Cytosim | Nedelec and Foethke, 2007, PMID:19293826 | ||
| Software, algorithm | Python | https://www.python.org/ | RRID:SCR_008394 | |
| Software, algorithm | Seaborn | https://seaborn.pydata.org/ | RRID:SCR_018132 | |
| Software, algorithm | NumPy | https://numpy.org/ | RRID:SCR_008633 | |
| Software, algorithm | Pandas | https://pandas.pydata.org/ | RRID:SCR_018214 | |
| Software, algorithm | Adobe Illustrator | Adobe | RRID:SCR_010279 | Generation of cartoons and figures |
| Other | 8-well Chambered Coverglass w/ non-removable wells | Thermo | Cat# 155409 | |
| Other | Precision cover glasses thickness No. 1.5H | Marienfeld | Cat# 0107032 | Specific for ExM and STED samples |
| Other | silicone mold, 13mm inner diameter | Sigma-Aldrich | Cat# GBL664107 | |
| Other | Phalloidin-Alexa488 | Life Technologies | Cat# 12379 | IF (1:400) |
| Other | Phalloidin-Alexa594 | Life Technologies | Cat# 12381 | IF (1:400) |
| Other | DAPI-containing Vectashield mounting medium | Vector Laboratories | Cat# H-1200-10 | |
| Other | Vectashield mounting medium | Vector Laboratories | Cat# H-1000-10 | |
| Other | Prolong Gold | Thermo Fisher | Cat# P10144 |