Table 1.

The sequences of the primers used in this work for vector construct, screening the positive transform, and transcript assay

Gene	Accession	Primer Sequence (5′ → 3′) a	Protein	Ortholog gene in Arabidopsis	Function	Reference (s)
rty	AY050987	F: AAGCTTATGAGC GAAGAACAACCACACGC R: GAGCTCTTACAT TTCGAGATTATTATCACTC	tyrosine aminotransferase	AT2G20610	Regulation of cell growth by extracellular stimulus, glucosinolate biosynthetic process, adventitious root development, indoleacetic acid biosynthetic process	[6]
NPTII	AAL92039	F: CCGGTATAAAGGGACCACCT R: ATGTTGCTGTCTCCCAGGTC	neomycin phosphotransferase II	–	Neomycin phosphotransferase II as selectable markers in transformed plant screening	[81]
Actin	XM_004306544	F: GGCCGTTCTCTCTCTGTATGC R: TTCTGGGCACCTGAATCTC	Actin	–	Actin	[29]
FvRD29A	XM_011472069	F: AGAGGCACGCCACGAATA R: GCCAGTTTGGTCCTTGCT	Cold regulated protein	AT5G52310	Responded to abscisic acid, cold, desiccation, mannitol, osmotic stress, reactive oxygen species, salt stress, water deprivation, and wounding	[34]
FvNCED3	XM_004300619	F: TCACCACAAGAGATTCCTTTCT R: ATGGCTGTGAGTAGGTTGGA	Encodes 9-cis-epoxycarotenoid dioxygenase	AT3G14440	Regulated in response to drought and salinity	[32]
FvDREB2A	XM_004307642	F: TGCTGCGAGTCTACTACGATGTCT R: TGATCCATAGGAACCTCGCTTT	Encodes a transcription factor binds to DRE/CRT cis elements	AT5G05410	Regulates expression of many water stress–inducible genes.	[35]
FvABA8	XM_004300635	F: ATGGAACTACTCAGCCTCAACT R: ATGGCGAGCGGAAATGAG	Encodes a protein with ABA 8′-hydroxylase	AT4G19230	Involved in ABA catabolism.	[46]
FvABI1	XM_011469096	F: GCATGGCTAAAGCTAGTAACAGAC R: GCTCCTCCAGTGTTATCTTCTTGT	Protein phosphatase 2C family protein	AT4G26080	Involved in abscisic acid (ABA) signal transduction	[33]
FvPYL9	XM_004306638	F: GGGAGTCTTAGGGAAGTGAATG R: GGATGGACGGTGATAATAGAAGAG	Encodes regulatory components of ABA receptor	AT1G01360	Interacts with and regulates the type 2C protein phosphatases (PP2Cs).	[78]
FvPP2C	XM_004291463	F: ACGAAATATGCCGAGAAGCGAAAG R: TTGGCGGAAATCGTTAGGCTCAT	Encodes a member of the group A protein phosphatase 2C	At1g07430	Negative regulation of abscisic acid-activated signaling pathway.	[36]
FvAAO1	XM_004296223	F: TCAACCGCTGCTCCATCACG R: GTCGGTCAGTGGTGTTTTGGGC	Encodes aldehyde oxidase 1	AT5G20960	Involved abscisic acid biosynthetic process, auxin biosynthetic process.	[76]
FvPIN1	XM_004303589	F: CAAAGCCGCAAAGATAGAGCC R: TGGGATGCCCTGACCTGAT	Encodes an auxin efflux carrier involved in shoot and root development	AT1G73590	Involved in the maintenance of embryonic auxin gradients	[82]
FvARF7	XM_004287612	F:ACAATCACTGGCATTAGCGAGC R: GAGGTGGGCAGATGTAGAAAGG	Encodes an auxin-regulated transcriptional activator	AT5G20730	Involved in auxin-activated signaling pathway, lateral root development, lateral root formation.	[83]
FvMAX2	XM_011468656	F:ACTGTGGCGATTTGACGGAT R: CCACAACAAAGAAGCCAGCGT	F-box leucine-rich repeat family of proteins	AT2G42620	Responses to abiotic stress conditions.	[84]
FvYUC1	JF898837	F: CAAATGGTTGGAAAGGTGAGC R: CGAGGACATTGAGCGGTGTTGGA	Encodes a member of the YUC family	AT4G32540	Involved in auxin biosynthetic process.	[72]
FvYUC3	JX417080	F: ATTTCCCAACCTACCCAACC R: AGTCTTGACGAGCCAAAGTC	Encodes a member of the YUC family	AT1G04610	Involved in auxin biosynthetic process, oxidation-reduction process, response to ethylene.	[72]
FvGA3ox	XM_004302902	F: CCTGTAAGAATCTCCGAAGCC R: CGTGTAGTGAGTTGAAGTCTGC	gibberellin 3-beta-dioxygenase activity,	AT1G15550	Involved in later steps of the gibberellic acid biosynthetic pathway.	[85]

^aF forward primer, R reverse primer. Underlined characters indicate the restriction enzyme cutting site