KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| GCLC (Mouse polyclonal Ab) | Santa Cruz Biotechnology | Cat#: sc-390811 Lot#: 1917 RRID: AB-2736837 |
| GSS (Mouse polyclonal Ab) | Novus Biologicals | Cat#: NBP2–03351 Lot#: A01 RRID: N/A |
| GCLM (Rabbit polyclonal Ab) | GeneTex | Cat#: GTX114075 Lot#: 40156 RRID: AB_10619535 |
| GPX4 (Mouse monoclonal Ab) | R&D Systems | Cat#: MAB5457 Lot#: CCXW0218061 RRID: AB_2232542 |
| β-Actin (Mouse monoclonal Ab) | Thermo Fisher Scientific | Cat#: AM4302 Lot#: 00867595 RRID: AB_2536382 |
| xCT (Rabbit polyclonal Ab) | Abcam | Cat#: ab37185 Lot#: GR3275067–8 RRID: AB_778944 |
| HSP90 (Rabbit polyclonal Ab) | Cell Signaling Technology | Cat#: 4874S Lot# 5 RRID: 2121214 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Sytox Green | Thermo Fisher Scientific | Cat#: S7020 |
| Cytotox Red | Thermo Fisher Scientific | Cat#: NC1015259 |
| DMSO | VWR Scientific Inc | Cat#: 97063–136 |
| 0.4% PFA in PBS | Thermo Fisher Scientific | Cat#: J19943-K2 |
| Tamoxifen | Sigma-Aldrich | Cat#: T5648–5G |
| Arginine | Sigma-Aldrich | Cat#:A6969–25G |
| Aspartate | MP Biomedicals | Cat#:219463380 |
| Asparagine | Sigma-Aldrich | Cat#:A4159–25G |
| Glutamate | Sigma-Aldrich | Cat#:G8415–100G |
| Glutamine | VWR | Cat#:VWRL0131–0100 |
| Glycine | VWR | Cat#:BP381–1 |
| Histidine | Sigma-Aldrich | Cat#:H5659–25G |
| Hydroxy-L-proline | VWR | Cat#:TCH0296–5G |
| Isoleucine | VWR | Cat#:AAJ63045–14 |
| Leucine | Sigma-Aldrich | Cat#:L8912–25G |
| Lysine | Sigma-Aldrich | Cat#:L8662–25G |
| Methionine | Sigma-Aldrich | Cat#:M5308–25G |
| Phenylalanine | Sigma-Aldrich | Cat#:P5482–25G |
| Proline | Sigma-Aldrich | Cat#:P5607–25G |
| Threonine | VWR | Cat#:97064–026 |
| Tryptophan | Sigma-Aldrich | Cat#:T8941–25G |
| Tyrosine | Sigma-Aldrich | Cat#:T1145–25G |
| Valine | Sigma-Aldrich | Cat#:V0513–25G |
| Glucose | Sigma-Aldrich | Cat#:G7021–100G |
| [2H5]-GSH | Santa Cruz Biotechnology | Cat#: sc-489493 |
| [13C3, 15N]-cysteine | Cambridge Isotope Laboratories | Cat#: CNLM-3871-H-0.25 |
| [2, 3, 3-2H3]-serine | Cambridge Isotope Laboratories | Cat#: DLM-582–0.1 |
| [13C3]-serine | Cambridge Isotope Laboratories | Cat#: CLM-1574-H-0.1 |
| [13C5, 15N2]-glutamine | Cambridge Isotope Laboratories | Cat#: CNLM-1275-H-0.1 |
| METABOLOMICS AMINO ACID MIX STANDARD | Cambridge Isotope Laboratories | Cat#: MSK-A2–1.2 |
| γ-glutamyl-alanine | Santa Cruz Biotechnology | Cat#: sc-300878 |
| γ-glutamyl-glycine | Bachem | Cat#: 4003498.0001 |
| γ-glutamyl-leucine | Bachem | Cat#: 4005004.0001 |
| γ-glutamyl-valine | Bachem | Cat#: 4003707.0250 |
| MeOH (HPLC grade) | Sigma Aldrich | Cat#: 34860–1 L-R |
| H2O (HPLC grade) | Fisher Chemical | Cat#: W5–1 |
| Acetonitrile (HPLC grade) | Honeywell | Cat#: 34967 |
| N-ethylmaleimide (NEM) | Alfa Aesar | Cat#: 40526–06 |
| Blasticidin | Invivogen | Cat#: ant-bl-1 |
| Puromycin | Invivogen | Cat#: ant-pr-1 |
| Hygromycin | Invivogen | Cat#: ant-hg-1 |
| Glutamate diethyl ester (GluEE) | TCI Chemicals | Cat#: G0179–5G |
| Cystine | Sigma Aldrich | Cat#: C6727–25G |
| Erastin | Cayman Chemical | Cat#: 17754 |
| Ferrostatin-1 (Fer-1) | Cayman Chemical | Cat#: 17729 |
| Deferoxamine (DFO) | Sigma Aldrich | Cat#: D9533–1G |
| AOA | Santa Cruz Biotechnology | Cat#: sc-207410 |
| SHIN-1 | Dr. Joshua Rabinowitz Department of Chemistry and Lewis-Sigler Institute for Integrative Genomics (Princeton University) |
(Ducker et al., 2017) |
| L-Buthionine-(S,R)-Sulfoximine (BSO) | Cayman Chemical or Sigma Aldrich | Cat#: 14484 or Cat#: B2515–500MG |
| Cyst(e)inase | Dr. Everett Stone Department of Molecular Biosciences (University of Texas Austin) |
(Cramer et al., 2017) |
| KI-696 | MedChem Express | Cat#: HY-101140 |
| 2755 Glutamate Standard | YSI | Cat#: 027055 |
| Critical Commercial Assays | ||
| CellROX green | Fisher Scientific | Cat#: C10444 |
| BODIPY-C11 | Invitrogen | Cat#: C10445 |
| MitoSOX Red | Invitrogen | Cat#: M36008 |
| Experimental Models: Cell Lines | ||
| PC9 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_B260 |
| H810 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1590 |
| H2172 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1537 |
| Calu3 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_0609 |
| H1581 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1479 |
| H1975 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1511 |
| H2087 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1524 |
| H2347 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1550 |
| H1792 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1495 |
| H1944 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_1508 |
| H460 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_0459 |
| HCC15 | Dr John Minna, Hamon Cancer Center Collection (University of Texas-Southwestern Medical Center) | RRID: CVCL_2057 |
| H2009 | ATCC | Cat#: CRL-5911 RRID: CVCL_1514 |
| H1299 | ATCC | Cat#: CRL-5803 RRID: CVCL_0060 |
| H1993 | ATCC | Cat#: CRL-5909 RRID: CVCL_1512 |
| H441 | ATCC | Cat#: HTB-174 RRID: CVCL_1512 |
| A549 | ATCC | Cat#: CCL-185 RRID:CVCL_1561 |
| NRF2 KO A549 | Dr. Laureano de la Vega | (Torrente et al., 2017) |
| Lenti-X 293T | Clontech | Cat#: 632180 RRID: N/A |
| Experimental Models: Organisms/Strains | ||
| Gclcf/f | (Chen et al., 2007) | N/A |
| R26-CreERT2 | (Ventura et al., 2007) | N/A |
| Oligonucleotides | ||
| Guide RNA for lentiCRISPR-V2 GCLC. Forward: 5’-caccgTAGATGTGCAGGAACTGG-3’ Reverse: 5’-aaacCCAGTTCCTGCACATCTAc-3 |
(Harris et al., 2019) | N/A |
| Guide RNA for lentiCRISPR-V2 GSS. Forward: 5’-caccgGGTCTCTGGACCAAGACCGA-3’ Reverse: 5’-aaacTCGGTCTTGGTCCAGAGACc-3’ |
This study | N/A |
| PCR primer for pLenti-hygromycin-GCLC. Forward: 5’-cgactctagaggatccatggggctgctgtcc-3’ Reverse: 5’-gaggttgattgtcgacctagttggatgagtcagttttacttcc-3’ |
This study | N/A |
| PCR primer for pLenti-hygromycin-GSS. Forward: 5’-cgactctagaggatccatggccaccaactgg-3’ Reverse: 5’-gaggttgattgtcgactcacacagggtatgggttgtc-3’ |
This study | N/A |
| Site directed mutagenesis primer for pLenti-hygromycin-GCLCRes. Forward: 5’- CCTGCACATCTACCACG −3’ Reverse: 5’- AACTGGAAGATCCCGTGCCG −3’ |
This study | N/A |
| Site directed mutagenesis primer for pLenti-hygromycin-GSSRes. Forward: 5’- AAGACCGAAGACTGTTTGTGG −3’, Reverse: 5’- GGTCCAGAGACCCCTTTT-3’ |
This study | N/A |
| Recombinant DNA | ||
| lentiCas9-Blast | Addgene | Cat#: 52962 |
| lentiCRISPR-V2 | Addgene | Cat#: 52961 |
| lentiCRISPR-V2 GCLC; Using BsmBI restriction site, primers were annealed and cloned to progenitor of lentiCRISPR-V2. |
This study | N/A |
| lentiCRISPR-V2 GSS; Using BsmBI restriction site, primers were annealed and cloned to progenitor of lentiCRISPR-V2 |
This study | N/A |
| MGC Human GCLC Sequence-Verified cDNA (pCMV-SPORT6-GCLC) | Dharmacon | Cat#: MHS6278–202759380 |
| MGC Human GSS Sequence-Verified cDNA (pOTB7-GSS) | Dharmacon | Cat#: MHS6278–202830404 |
| pLenti-hygro-GFP | Addgene | Cat#: 17446 |
| pLenti-hygro-GCLC resistant to sgGCLC (pLGH-GCLCRes); The GFP of pLenti-hygro-GFP was excised and replaced with human GCLC cDNA using MGC Human GCLC Sequence-Verified cDNA (pCMV-SPORT6-GCLC) as a PCR template. The pLenti-hygro-GCLC resistant to sgGCLC was further generated by the site-directed mutagenesis. | This study | N/A |
| pLenti-hygro-GSS resistant to sgGSS (pLGH-GSSRes); The GFP of pLenti-hygro-GFP was excised and replaced with human GSS cDNA using MGC Human GSS Sequence-Verified cDNA (pOTB7-GSS) as a PCR template. The pLenti-hygro-GSS resistant to sgGSS was further generated by the site-directed mutagenesis. |
This study | N/A |
| pCMV-dR8.2 dvpr | Addgene | Cat#: 8455 |
| pCMV-VSV-G | Addgene | Cat#: 8454 |
| Software and Algorithms | ||
| EL-Maven | https://resources.elucidata.io/elmaven | Version 0.6.1, 0.10.0, or 0.11.0 |
| GraphPad Prism | https://www.graphpad.com/scientific-software/prism/ | Version 8 |
| IncuCyte Zoom | Essen BioScience | IncuCyte Zoom 2018A |
| IncuCyte S3 | Essen BioScience | IncuCyte S3 2018B or 2020A |
| Accuri™ | BD Biosciences | Version C6 |
| FlowJo | BD Biosciences | Version 10.7.1 |
| Other | ||
| RPMI 1640 Medium Modified w/o L-Glutamine, w/o Amino acids, Glucose (Powder) | US Biological | Cat# R9010–01 |
| cysteine/cystine/glutamine/methionine free RPMI | MP Biomedicals | Cat# 091646454 |
| Dialyzed FBS (dFBS) | Sigma Aldrich | Cat# F0392 |