Table 3. Linker and primer sequences used for HIV integration sites analysis.
| Name | 5' modification | Sequence | 3' modification |
|---|---|---|---|
| Linker top | - | g*cagcgataacaatttcacggcgccactgcaggacgtac*t*g*t*t | - |
| Liker bot | Phosphorylated | a*cagtacgtcctgcagtggcgcgccttgactgagcttta | Dideoxycytosine |
| LTR 1st | Biotinylated | cttaagcctcaataaagcttgccttgag | - |
| Linker 1st | - | gcagcggataacaatttcacg | - |
| LTR 2nd | MID | tgactctggtaactagagatccctcag | - |
| Linker 2nd | MID | tcactgcaggacgtactgtt | - |
Sequences used for primers and linkers to detect HIV integration sites. The star (*) indicates phosphorothiated nucleotide. MID stands for multiplex identifier sequence.