Table 1.
Gene ID of the PHAS loci | Gene annotation | PhasiRNA production region | sRNA trigger ID | sRNA trigger sequence | Binding sites of sRNA trigger on gene of PHAS loci | Cleavage sites discovered by degradome on gene of PHAS loci |
---|---|---|---|---|---|---|
21-nt PHAS loci | ||||||
LOC_Os01g57968.1 | expressed protein | 361–1765 | OSsRNA-1 | GCUUUUUUGAACUUUUUCAUU | 424–444 | 435 |
LOC_Os02g18750.1 | expressed protein | 188–920 | OSsRNA-2 | UUUUUUGGCAUUCUGUAACUUG | 176–197 | 188 |
LOC_Os04g25740.1 | expressed protein | 1908–2159 | osa-miR2118f | UUCCUGAUGCCUCCCAUUCCUA | 1875–1896 | 1887 |
LOC_Os05g43650.1 | expressed protein | 1494–1620 | OSsRNA-3 | GAUUCAUUAACUUCAAUAUGAA | 1528–1549 | 1540 |
LOC_Os06g30680.1 | WD domain, G-beta repeat domain containing protein | 62–208 | OSsRNA-4 | UUCCUGGAGCCGCUCAUUCCAU | 50–71 | 62 |
24-nt PHAS loci | ||||||
LOC_Os01g37325.1 | retrotransposon protein | 1565–1760 | OSsRNA-14 | AAAAGUAGAUGGAUGCGGAGAC | 1676–1697 | 1688 |
LOC_Os02g20200.1 | retrotransposon protein | 4856–5052 | OSsRNA-15 | UAGAUGCUGUCCUGAAAAGGUG | 4873–4894 | 4885 |
OSsRNA-16 | AGCCAUGCUAGUCUAAGAGGG | 5007–5027 | 5018 | |||
LOC_Os02g55550.1 | F-box/LRR-repeat protein 14 | 905–1101 | OSsRNA-17 | UAGAUGCUGUCCUGAAAAGGUG | 922–943 | 934 |
LOC_Os04g45834.2 | DUF584 domain containing protein | 1051–1307 |
OSsRNA-18/ OSsRNA-19 |
UUAAUAUUUAUAAUUAGUGUCU/ UUAAUAUUUAUAAUUAAUGUCC |
1103–1124 | 1115 |
LOC_Os09g14490.1 | TIR-NBS type disease resistance protein | 4585–4757 | OSsRNA-20 | UAGAUGCUGUCCUGAAAAGGUG | 4578–4599 | 4590 |