KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Anti-Phospho-Akt Ser473 (D9E) | Cell Signaling Technology | Cat# 4060; RRID: AB_2315049 |
| Anti-Akt (pan) (C67E7) | Cell Signaling Technology | Cat# 8596; RRID: AB_10890703 |
| Anti-IL-1 β (for Western Blot) | Genetex | Cat# GTX74034; RRID: AB_378141 |
| Anti-β-Actin (13E5) | Cell Signaling Technology | Cat# 5125; RRID: AB_1903890 |
| Anti-IL-1 β (for neutralization) | Invitrogen | Cat# MM425B; RRID: AB_223529 |
| Mouse IgG1 kappa (Isotype Control for neutralization studies) | Invitrogen | Cat# 14-4714-82; RRID: AB_470111 |
| FcR Blocking Reagent, mouse | Miltenyi Biotec | Cat# 130-092-575 |
| eFluor 450 anti-CD45.2 | eBioscience | Cat# 48-0454-82; RRID: AB_11042125 |
| PE-Cy7 anti-CD45.1 | eBioscience | Cat# 25-0453-82; RRID: AB_469629 |
| PE anti-CD115 (CSF-1R) | BioLegend | Cat# 135505; RRID: AB_1937254 |
| PerCP/Cyanine5.5 anti-Ly-6G | BioLegend | Cat# 127615; RRID: AB_1877272 |
| BV711 Rat Anti-Mouse CD43 | BD Biosciences | Cat# 740668; RRID: AB_2740356 |
| APC Rat Anti-Ly-6C | BD Biosciences | Cat# 560595; RRID: AB_1727554 |
| APC/Cy7 anti-B220 | BioLegend | Cat# 103223; RRID: AB_313006 |
| PE-eFluor 610 anti-CD3e | eBioscience | Cat# 61-0031-82; RRID: AB_2574514 |
| Brilliant Violet 510 anti-CD8a | Biolegend | Cat# 100751; RRID: AB_2561389 |
| FITC anti-CD4 | eBioscience | Cat# 11-0042-82; RRID: AB_464896 |
| Biotin anti-CD127 (IL-7Rα) | Biolegend | 135005; RRID: AB_1953262 |
| Biotin Mouse Lineage Panel (biotinylated antibodies against CD3e, CD45R, Ly-6C/G, CD11b and TER-119) | BD Biosciences | Cat# 559971; RRID: AB_10053179 |
| BV421 Streptavidin | BD Biosciences | 563259 |
| PerCP/Cyanine5.5 anti-CD45.1 | BioLegend | Cat# 110727; RRID: AB_893348 |
| APC anti-CD45.2 | BioLegend | 109813; RRID: AB_389210 |
| PE anti-cKit | BD Biosciences | Cat# 553355; RRID: AB_394806 |
| PE-Cy7 anti-Sca-1 | BD Biosciences | Cat# 558162; RRID: AB_647253 |
| BV711 anti-CD115 | Biolegend | Cat# 135515; RRID: AB_2562679 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Humulin R 100 IU/ml (for in vivo studies) | Lilly | HI0210 |
| C16 Ceramide (d18:1/16:0) | Avanti | 860516P |
| LPS-EK (LPS from E. coli K12) | InVivoGen | tlrl-peklps |
| Recombinant Murine IFN-γ | Peprotech | 315–05 |
| 3-Isobutyl-1-methylxanthine (IBMX) | Sigma-Aldrich | I5879 |
| Dexamethasone | Sigma-Aldrich | D4902 |
| Human Insulin (for cell culture studies) | Sigma-Aldrich | I9278 |
| DMEM (Dulbecco’s Modified Eagle Medium) | GIBCO | 41965–039 |
| DMEM, low glucose, pyruvate | GIBCO | 31885–023 |
| RPMI Medium 1640 | GIBCO | 11875093 |
| Fetal Bovine Serum | Sigma-Aldrich | F7524 |
| Calf Bovine Serum, Iron Fortified | ATCC | 30–2030 |
| Penicillin-Streptomycin | GIBCO | 15140122 |
| Phosphate-Buffered Saline | GIBCO | 10010023 |
| Fluid Thioglycollate Medium | Difco BD | 225650 |
| ECL Select Western Blotting Detection Reagent | Sigma-Aldrich | GERPN2235 |
| Cell Lysis Buffer (10X) | Cell Signaling Technology | 9803S |
| phosSTOP (phosphatase inhibitor tablets) | Roche | 4906845001 |
| cOmplete (protease inhibitor cocktail tablets) | Roche | 11697498001 |
| SDS Solution 20% (w/v) | BioRad | 1610418 |
| Restore Western Blot Stripping Buffer | Thermo Scientific | 21059 |
| Restore PLUS Western Blot Stripping Buffer | Thermo Scientific | 46430 |
| Sulfatrim Pediatric (sulfamethoxazole-trimethoprim oral suspension) | STI Pharma, LLC | 54879-007-16 |
| eBioscience 1X RBC Lysis Buffer | Invitrogen | 00-4333-57 |
| UltraComp eBeads (compensation beads) | Invitrogen | 01-2222-42 |
| Collagenase Type 1 | Worthington Chemical Corporation | LS004196 |
| DNase I | Roche | 10104159001 |
| TRIzol | Invitrogen | 15596018 |
| DAPI | Thermo Scientific | 62248 |
| MCC950 | Provided by Dr. M.A. Cooper | N/A |
| Critical Commercial Assays | ||
| Pierce BCA Protein Assay Kit | Thermo Scientific | TJ268818 |
| Glucose Uptake-Glo Assay | Promega | J1341 |
| RNeasy Lipid Tissue Mini Kit | QIAGEN | 74804 |
| High-Capacity cDNA Reverse Transcription Kit | Applied Biosystems | 4368814 |
| SYBR Green PCR Master Mix | Applied Biosystems | 4309155 |
| Mouse IL-1 beta/IL-1F2 Quantikine ELISA | Bio-Techne R&D Systems | SMLB00C |
| Experimental Models: Cell Lines | ||
| 3T3-L1 cell line | ATCC | CL-173 |
| Experimental Models: Organisms/Strains | ||
| CD45.1 (B6.SJL-Ptprca Pepcb/BoyJ) mice | The Jackson Laboratory | Stock No: 002014 |
| TET2-KO (B6(Cg)-Tet2tm1.2Rao/J) mice | The Jackson Laboratory | Stock No: 023359 |
| Oligonucleotides | ||
| Primer 1 for TET2 KO mice genotyping (forward, WT allele): AGCTGATGGAAAATGCAAGC; | Integrated DNA Technologies | N/A |
| Primer 2 for TET2 KO mice genotyping (forward, KO allele): GCCACTTTAGAA GCCTATTGGA; | Integrated DNA Technologies | N/A |
| Primer 3 for TET2 KO mice genotyping (reverse, WT/KO alleles): TCTCAGAGCAAAGAGGACTGC. | Integrated DNA Technologies | N/A |
| Primers for Real-Time PCR: see Supplemental Table | This paper | N/A |
| Software and Algorithms | ||
| FlowJo software | FLOWJO | RRID: SCR_008520 |
| GraphPad Prism 7 software | GraphPad | RRID: SCR_002798 |
| QuantStudio software | Applied Biosystems | RRID: SCR_014246 |
| ImageQuant analysis software | GE HEalthcare | RRID: SCR_014246 |
| Other | ||
| BD LSRII Flow Cytometer | BD Biosciences | N/A |
| BD FACSymphony Flow Cytometer | BD Biosciences | N/A |
| ViiA 7 Real-Time PCR System | Applied Biosystems | N/A |
| ImageQuant LAS 4000 Biomolecular imager | GE Healthcare | N/A |
| Microtainer Tubes (EDTA-coated) | BD Biosciences | 365974 |
| Mini-PROTEAN TGX Stain-Free Precast Gels 10% | Bio-Rad | 456–8033 |
| Immobilon-P Transfer Membrane; PVDF | Millipore | IPVH85R |
| Mini-osmotic pumps, model 2006 | Alzet | 2006 |
| Mouse Diet, High Fat, 60% Fat Calories | Bio-Serv | F1850 |
| Teklad global 18% protein rodent diet | Envigo | 2018 |